1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
KIM [24]
3 years ago
9

Scoliosis can be cured with a brace.true or false?​

Biology
1 answer:
Paraphin [41]3 years ago
5 0

Answer: It cannot be fully cured but it may help

Explanation:

You might be interested in
What protects plants from threats that could potentially kill the plant?
DIA [1.3K]
B. Xylem and phloem
3 0
3 years ago
Read 2 more answers
A certain reptile species is an herbivore and exists only on an isolated island.
Oksanka [162]

The reptile produce few offsprings having no unique traits, and the vegetation as well changes quickly so that it can be protected from the reptile species.

Explanation:

Majority of the reptiles lay eggs or give birth to young ones such as squamates , this is done in two ways such as by keeping the egg inside the body of the mother or by developing offsprings without any formation of eggs. Climate change is having an adverse effect on the reptiles , a physiological as well as ecological change is occurring as a result reptiles as well as other species are in danger. Climate change is having an adverse effect on snakes , that is, there is fall in range size of snakes.

3 0
3 years ago
The formula F=mXa means "force equals motion times acceleration."<br> True<br> False
Alex787 [66]

Answer:

it's false

Force is mass times acceleration.

8 0
3 years ago
C2H5OH<br> How many elements are there in a molecule of<br> Ethanol shown in the above formula?
Svetllana [295]

Answer:

9 elements

Explanation:

there are 2 C

6 H

1 O

8 0
3 years ago
Read 2 more answers
The picture shows an experimental set up for the process of osmosis. The potato has a cavity on top, as shown in the picture. So
LiRa [457]

A) water from the beaker has moved into the cavity.

mark me brainlest please

8 0
3 years ago
Other questions:
  • In how many different ways can 7 swimmers be lined up for a race?<br> 5040<br> 42<br> 332<br> 72
    5·1 answer
  • PLEASE HELP
    10·2 answers
  • How does water's properties interact to sustain life?
    15·1 answer
  • Meiosis produces four new cells with ______ the chromosomes as the parent cell. two-thirds one-half one-quarter one-third
    9·1 answer
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • Which of the following is the correct order for the major parts of the gastrointestinal tract?
    10·1 answer
  • 1. Common monosaccharides have a backbone of five or six carbon atoms and two or more
    11·1 answer
  • Please help!!!!!!!!!!!!
    8·1 answer
  • How do naturally occurring hormones affect plants?
    9·1 answer
  • If you lived on Mercury, you would:
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!