1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
lozanna [386]
3 years ago
8

Which level on the energy pyramid has the third most energy?

Biology
2 answers:
eduard3 years ago
7 0

primery

cosumers

Explanation:

alexgriva [62]3 years ago
6 0
C.secondary consumers.

You might be interested in
Bacteria and archaea differ in (1 point)
Step2247 [10]
<span>Apart from their habitats, Bacteria and Archaea differ in cell wall structure and membrane lipid composition. All bacteria have peptidoglycans in the cell wall whereas the archaea do not. Both also are different in RNA polymerases and thus in their protein synthesis. </span>
5 0
3 years ago
Read 2 more answers
What pathogens cause infectious disease?
MrMuchimi
Viruses, bacteria, fungus,Protozoa and worms
8 0
3 years ago
Read 2 more answers
Need help I will give you 20 points plsss
dybincka [34]

Answer:

III3 will be "pp" lower case p

II2 will be Pp

Explanation:

As we know the trait is caused by dominant alleles. III3 is not affected so she will have two recessice alleles so 2 lower case p.

III2 is affected so the person will have one dominant allele P and one recessive. The dominant is from the father and the recessive is from the mother.

Hope that helps

7 0
3 years ago
Read 2 more answers
Pls help
bixtya [17]
The probability of long hair is 50%. The probability of short hair is also 50%. So, the probability of one of their offspring having long hair is 50%
5 0
2 years ago
What is a complete protein?
andrew-mc [135]
A complete protein<span> (or whole protein) is a source of protein that </span>contains<span> an adequate proportion of </span>all nine<span> of the </span>essential amino acids<span> necessary for the dietary needs of </span><span>humans.

Answer: C

Hope this Helps! :3

</span>
6 0
3 years ago
Read 2 more answers
Other questions:
  • Humans are able to digest cellulose even though we lack the digestive enzymes to break the bond linking the glucose molecules.
    5·1 answer
  • Which are characteristics of all living things? check all that apply.
    12·1 answer
  • Which of the following is NOT a nitrogen base found DNA?
    12·2 answers
  • The mammary glands enlargement during pregnancy primarily as a consequence of what hormonal process?
    15·1 answer
  • How is the mass number calculated for an element
    6·1 answer
  • The sex hormone testosterone _____.
    14·1 answer
  • Candace has two diagrams of particles of substance A and substance B as shown below. She is classifying them as either pure subs
    9·2 answers
  • AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA
    8·1 answer
  • The two strands of DNA that make up a double helix o are identical to each other are held together by covalent bonds are oriente
    9·1 answer
  • The cell membrane is a unique structure that has many functions.
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!