1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
vova2212 [387]
2 years ago
12

i am so lost and my brain is so over worked, this is the last question before i’m done the course! pls help

Biology
2 answers:
nataly862011 [7]2 years ago
7 0

Answer:

-birds

-amphibians

-reptile

-mammal

-bony fish

Explanation:

Misha Larkins [42]2 years ago
7 0

Answer:

1(ex): Jawless fish, Lamprey

2: Birds, sparrow

3: Reptiles, snake

4: Amphibians, frog

5: Mammals, human

6: Cartilaginous fish, shark

7: Bony fish, Salmon

Explanation:

You can just put the words from the word bank into the boxes and connect them to the ones in the boxes in the second column I put them in order for you so you can just put them in that order. I hope you get some rest and sleep early. And congrats on finishing your course!

You might be interested in
Where do plants obtain the oxygen necessary to utilize foods? directly from products of photosynthesis from the splitting of wat
IceJOKER [234]

Answer:

from the splitting of water molecule.

Explanation:

The splitting of water molecules  by sunlight is called Photolysis. This is the first reaction in photosynthesis; which occurs by catalysis  of enzymes of Photo system 11.

It involves the splitting of water molecules into;

hydrogen ion/protons.

Oxygen

and electron.

<u> Oxygen is  the by product liberated into the atmosphere, for animals to inhale for the process of cellular respiration</u><u>.</u>This is the source of oxygen fro cellular respiration in animals.

the hydrogen ions combined with electrons from photosystem 1 to reduce NADP .The latter is used to reduce C02  to form carbohydrate in light independent reaction

4 0
3 years ago
A water-soluble hormone binds to its receptor on the plasma membrane. Arrange the events that follow in correct sequence. (1) al
Nat2105 [25]

Answer:

G-protein subunits bind to the receptor

GTP binds to the alpha subunit replacing GDP

G-protein subunits separate from the receptor

alpha subunit separates from other two subunitsalpha subunit-GTP complex alters cell activity

Explanation:

5 2 3 4 1

6 0
3 years ago
Compare and contrast the terms genotype and phenotype. Describe at least two ways that they are alike and two ways that they are
faltersainse [42]
Compare: They both are products of DNA. They both are equally important to a living organism. Contrast: Genotype is the genetic makeup, while Phenotype is the physical appearance. Genotype can't be seen but phenotype can.
4 0
2 years ago
What was the cause of the increase in the numbers of black moths in England in the 1800s
dezoksy [38]

"Like many moths in forests, the peppered moth tends to rest (or "perch") on tree trunks during the day. They do most of their flying at night. So it would probably be a good thing if the moths look similar to the trees that they perch on, right? Then they can be camouflaged from birds that want to eat them.


Before the Industrial Revolution, the light peppered moth was common, while the dark form was very rare. The light moths blended in with the light-colored trees. However, the Industrial Revolution changed the tree colors.


Dark form of the peppered moth

After the pollution from the Industrial Revolution started affecting trees, most of the collected peppered moths were of the dark form. Click for more detail.

As the trees darkened with soot, the light-colored moths were easier to see. They were eaten by birds more and more, while the rare dark colored moths blended in better on the darker trees. This made the dark colored moths have a higher survival rate. They lived longer and passed their dark colored genes onto their offspring or young. " got this from https://askabiologist.asu.edu/peppered-moth use that link if you need more of a explanation

5 0
3 years ago
Read 2 more answers
use the particle theory to explain why hot chocolate powder dissolves more rapidly in hot water than cold water
Vanyuwa [196]

Answer:

Since hot water has more kinetic energy, any particles that are suspended in it move at a faster rate than in cold water.

Explanation:

4 0
3 years ago
Other questions:
  • The newly-discovered organism Yawle nhoj, has a diploid chromosome number of 56. Suppose that one of the chromosome pairs fails
    13·1 answer
  • Using the information from the graph below, determine the optimal temperature for the enzyme glenkippie
    13·2 answers
  • What is the base-pairing rule for DNA?
    14·1 answer
  • The primary means for transmitting messages between the brain and the rest of the body is the ______.
    6·1 answer
  • The _____ Thory of disease asserted that many human diseases were the result of infection with microbes ,as opposed to other non
    6·1 answer
  • Which alternative hypothesis is made far less likely by having three R and K lines, rather than one of each?
    11·1 answer
  • Which of these processes can be associated with producing genetic abnormalities?
    11·2 answers
  • Giraffes with short necks tend to be unable to access enough food, while giraffes with long necks can reach more food at the top
    6·2 answers
  • TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
    11·1 answer
  • Alligators living in a pond is a example of<br><br> an ecosystem because
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!