1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
yaroslaw [1]
3 years ago
11

A substance that yields an anlon plus a hydrogen lon is a(n). salt base acid

Biology
2 answers:
Mekhanik [1.2K]3 years ago
6 0

Answer:

I have no idea what the question is.

Explanation:

But I really need points oof. please help.

statuscvo [17]3 years ago
3 0
The answer is acid :)
You might be interested in
What is an effect of a compromised immune system?
maks197457 [2]
The answer would be antibody production 
5 0
3 years ago
Read 2 more answers
The electron transport chain is named for Select one: a. the removal of unnecessary electrons from the cell b. the conversion of
Colt1911 [192]

Answer:

The correct answer is e. the passage of electrons from one energy-generating carrier to another

Explanation:

The electron transport chain is a series of proteins and organic molecules found in the inner membrane of the mitochondria. Electrons pass from one member of the transport chain to the next in a series of redox reactions. The energy released in these reactions is captured as a proton gradient, which in turn is used to form ATP in a process called chemosmosis.

These transport molecules, in the inner mitochondrial membrane, are reduced and oxidized, accepting electrons and transferring them to the next molecule, electrons descending from high energy levels to lower ones, that is, from one energy-generating carrier to another. When lowering to other levels, energy is released that will be used in the synthesis of ATP by oxidative phosphorylation.

4 0
3 years ago
Help me plz for free robux(to join my group)
Y_Kistochka [10]
The first one is D
A goes with T
C goes with G
And to remember this just think of (A)pple (T)ree
And then (C)ar (G)arage
6 0
2 years ago
Assuming no crossing over between the gene in question and the centromere, during what phase of meiosis do alleles segregate?
choli [55]

Answer:

During Anaphase stage

Explanation:

Meiosis is the type of cell division employed during gamete formation when each resulting gamete (daughter cell) has their chromosomal number reduced by half. Meiosis occurs in a two step division; Meiosis I and II. Meiosis I involves the separation of homologous chromosomes (similar but non-identical chromosomes received from each parent) while Meiosis II involves separation of sister chromatids (replicated chromosomes).

Alleles are present on the chromosomes which segregate or separate during the anaphase stage. Alleles received from each parent are separated in Anaphase I of meiosis I, which the identical replicated alleles are separated in anaphase of meiosis II.

7 0
3 years ago
What is the mRNA sequence to match the DNA sequence below:<br><br> TACGCTCCATATCGCTAATCGCCGGATCAGATT
Kazeer [188]
AUGCGAGGUAUAGCGAUUAGCGGCCUAGUCUAA because A goes to U; T goes to A; G goes to C; C goes to G.
8 0
3 years ago
Read 2 more answers
Other questions:
  • Students research unicellular, prokaryotic
    13·2 answers
  • Decribe how an ionic bond is formed?
    8·1 answer
  • Meiosis is key to genetic differences within a gene pool that helps to drive natural selection. Consider the processes involved
    6·2 answers
  • A client has black, sticky, tarry, foul-smelling stools from digested dark blood. which term should the nurse use in report to d
    13·1 answer
  • The articulation between the root of a tooth and the alveolar process of the mandible or maxilla is called the:
    7·1 answer
  • Linnaeus is considered the "Father of _____." Modern Taxonomy Botany Zoology
    6·2 answers
  • What does each region of the kidney have in it?​
    15·1 answer
  • Match each step of the scientific method with its description.
    11·1 answer
  • Describe different types of mutations
    9·2 answers
  • Which of the following would cause mountains to wear down to become more like hills over time?(1 point) Erosion that carries sma
    7·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!