Were going to need you to put the multiple choices up too.
Answer:
Antidiuretic hormone
Explanation:
Antidiuretic hormone that is synthesized and produced in the brain by the hypothalamus, is secreted from the pituitary gland, where it is stored. This hormone is released into the blood stream in response to changes in the water balance in the blood. This hormone helps the kidneys to control and regulate the amount of water in the blood
Answer:
This is a well conserved sequence.
Explanation: BLAST a way to match or align a string of DNA or protein sequence to those that are already in a database. The way that this is done is by using statistics carefully to calculate the significance of the match. The BLAST result will produce 4 categories Max Score, Total Score, Query cover, E-Value Percent Identity. The Accession will indicate database of the sequence. In this Sequence: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT covers over 98.08% identity to the coding sequence (cds) of insulin. This sequence appears to be in a conserved region for many of the listed organism. This suggest that this part of the coding sequence for this protein is highly conserved
Answer:
<em>The correct option is C) Humans from different locations can donate blood and organs to one another.</em>
Explanation:
Organisms belonging to the same species can interbreed and produce fertile offsprings. As humans all around the world can interbreed and produce fertile embryo hence all human beings belong to the same species. Also, the organs and blood of organisms from the same species can be transferred depending on the compatibility. It is less likely for the human body to reject a graft from other human being rather than another species. Although, xenotransplantation has been practiced in the laboratory by scientists but it has not produced any good results.
