1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
kvasek [131]
3 years ago
9

Which of the following organisms would be able to survive for long periods of time with no food source? Select all that apply.

Biology
1 answer:
DerKrebs [107]3 years ago
7 0

Answer:

tortoise

Explanation:

You might be interested in
Police Officer Amy Randall suspects that the driver of a car in front of her is driving under the influence of alcohol. She pull
Umnica [9.8K]

Answer:

The correct answer is option a, that is, cerebellum.

Explanation:

Alcohol acts as a CNS depressant. When more amount of alcohol is taken and the levels of alcohol rise within the body, some sections of the brain get influenced and a reduction in the functioning is witnessed in that particular part.  

The region of the brain accountable for coordinating movement and also some kinds of learning seems to be sensitive specifically to the consumption of alcohol. Thus, cerebellum is the part of the brain, which gets most affected due to the consumption of alcohol. Therefore, test is performed to witness the balance of an individual, as cerebellum is the part of the brain responsible for appropriate posture and balance.  

5 0
4 years ago
Why do humans<br> show variation?
Mars2501 [29]

Answer:

gugkugcoytci6r

Explanation:

Causes of Variation:

Causes of differences between individuals include independent assortment, the exchange of genes (crossing over and recombination) during reproduction (through meiosis) and various mutational events. There are at least three reasons why genetic variation exists between populations.

<em>PLEASE</em><em> </em><em>THANK</em><em>,</em><em> </em><em>RATE</em><em> </em><em>AND</em><em> </em><em>FOLLOW</em><em> </em><em>ME</em><em>,</em>

<em>AND</em><em> </em><em>PLEASE</em><em> </em><em>MARK</em><em> </em><em>ME</em><em> </em><em>AS</em><em> </em><em>"</em><em>BRAINLIEST</em><em>"</em><em> </em><em>ANSWER</em><em> </em>

<em>HOPE</em><em> </em><em>IT</em><em> </em><em>HELPS</em><em> </em><em>YOU</em><em> </em>

8 0
3 years ago
What is not a characteristic of the cortical nephrons?
Pani-rosa [81]

Answer:

Their nephron loop is closely wrapped with vasa recta.

Explanation:

Cortical nephrons are located in the cortex.

They form 85% of all the nephrons in the kidney. They are located mostly within superficial cortex of kidney. The loop of henle of a cortical nephron is relatively short and hence not closely wrapped with vasa recta. Efferent arteriole delivers blood to a network of peritubular capillaries.

3 0
3 years ago
What is a cell? How are they different from atoms?
Lapatulllka [165]

Explanation:

Cells are the basic building blocks of all living things. The human body is composed of trillions of cells.

cells are bigger than atoms. We can see cells with a microscope. Just as atoms have smaller parts called protons, neutrons, and electrons, cells have smaller parts, too. When you look at cells with a powerful microscope, you can clearly see hundreds of them.

4 0
3 years ago
A division or part of
azamat
If I am not mistaken, the answer is branch. For example a branch of the military is the U.S Navy.
5 0
3 years ago
Other questions:
  • The capital letter(s) that label a rock unit (e.g., KJk) on a geologic map represents the rock unit's _____. age range rock type
    8·2 answers
  • Which of the following is not a factor that has contributed to agricultural success in the US? A. expansive infrastructure and m
    14·2 answers
  • What part of speech is the first word in a scientific name?
    7·1 answer
  • This is formed as a waste product in photosynthesis and used as a reactant in respiration.
    14·1 answer
  • What is the function choroplast ?<br><br> what is the function of Golgi body ?
    11·2 answers
  • Where is the blood filtered first?​
    6·2 answers
  • Primary function of the central vacuole
    10·1 answer
  • 1-5 For the following DNA sequences, replicate the DNA<br> 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC
    13·1 answer
  • How does the photolysis of water benefit the biosphere?
    12·1 answer
  • When does crossing over occur in meiosis
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!