1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
zhenek [66]
3 years ago
5

How does the process of meiosis affect the genetic information of an offspring?

Biology
1 answer:
iragen [17]3 years ago
6 0

Answer: All the offspring receive identical genetic information

Meiosis creates new combinations of genetic material in each of the four daughter cells. These new combinations result from the exchange of DNA between paired chromosomes. This  means that the gametes produced through meiosis exhibit an range of genetic variation.

Explanation:

Hope this helped!!

You might be interested in
For this testable question write a proper hypothesis and identify the variables.
liubo4ka [24]
Hypothesis - there will be a relationship between the amount of gas per kilometer and the speed the man is going. This is because , more speed requires more gas / power.
The variables are - the amount
Of gas , and the speed in which he is going
6 0
2 years ago
Perform the following tasks:
liubo4ka [24]
The conditions on early Earth, some three to four billion years ago, are thought to be much different from what they are today. To begin with, the astronomical phenomenon called “the big bang” is defined by a theory proposing that the earth was one of the larger particles that coalesced after the initial universe explosion, or big bang, that spewed all the particles in the universe away from a central point and destined them to slowly revolve around that point. <span>
</span>
7 0
3 years ago
Which gaseous giants did the renaissance scientists such as galileo know about
kkurt [141]
The gaseous giants that Renaissance scientists such as Galileo knew are Jupiter Saturn.
4 0
3 years ago
Read 2 more answers
The pattern of growth in which the child is able to control the head and neck before the arms and legs is known as ________.
sergey [27]

Answer:

The pattern of growth in which the child is able to control the head and neck before the arms and legs is known as Cephalocaudal Growth.

Explanation:

Cephalocaudal Growth.

This type of growth pattern happens with the humans when they are infants, where fastest growth takes place at the upper part of the body which includes, head. Then the growth started with the gradually lower parts like neck, shoulder etc.

8 0
3 years ago
Woolly mammoths are no longer living. they are destroyed gone extinct hibernating
Dimas [21]
Woolly mammoths are extinct
5 0
3 years ago
Other questions:
  • Projections from the cell that move materials and mucus are:
    9·1 answer
  • Identify the five types of anxiety disorders
    15·1 answer
  • How would you expect the attenuation of light (like with increased turbidity) to influence net productivity? Why?
    13·1 answer
  • The phylogenetic tree illustrates the relationship between humans and our closest living relatives. The tree was based on bioche
    11·2 answers
  • What is the function of cilia in the trachea?
    6·1 answer
  • Why is a DNA molecule called a double helix?
    13·1 answer
  • What is the name given to the male cell in the flower​
    10·1 answer
  • What is the main cause of a human-created mass extinction?
    11·2 answers
  • Write the code for RNA from this DNA STRAND :<br><br> AAAAAATTTTTTCCCGGGGTTTATATATC
    15·1 answer
  • 1. Definition of Air Pressure - What is air pressure? (2 points)
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!