1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Airida [17]
3 years ago
11

HELP!! PLEASE!! AND STOP USING ME!!!! 17-19 PLEASE!!! IM STRUGGLING!

Biology
1 answer:
Anna35 [415]3 years ago
5 0

Answer:

A and d

Explanation:

You might be interested in
I actually need so much help with this, I’ll give extra points just PLEASE HELP
suter [353]
#2 is an exponential graph, #3 is linear horizontal, #4 is like graph 1, #5 is linear upwards but slowly, #6 like number 5, #7 like number 1, #8 like number 1
6 0
3 years ago
Draw the structure of DNA aand write a short note about it.​
artcher [175]

Answer:

DNA is made up of molecules called nucleotides. Each nucleotide contains a phosphate group, a sugar group and a nitrogen base. The four types of nitrogen bases are adenine (A), thymine (T), guanine (G) and cytosine (C). The order of these bases is what determines DNA's instructions, or genetic code.

Explanation:

i really hope this helps

please mark me as brainliest

4 0
3 years ago
What term refers to corps that mainly protect other crops during their early days?
nataly862011 [7]
Forage crops. pasture crops. Peas, peanuts, or corn is an example of such crops. ... mainly protects other crops during their early days
3 0
3 years ago
Read 2 more answers
Why is Mitochondria different in the cells of older people ?
Vlad1618 [11]
Well, mitochondria are the energy supplying organelles.

Knowing this, the mitochondria is different in the cells of older people because its been damaged, its called Mitochondrial Aging. When mitochondria age, just like us, they get damaged. And when they get damaged they damage our age, in a sense that we get older. This is how it is different in older people.
5 0
3 years ago
A spectrum for a given element is unique for that element. why is that so?
astra-53 [7]
The correct answer is B.
The electrons deal with most of the spectrum emissions. Whilst mass is technically a factor, the more precise answer would be B.
5 0
3 years ago
Other questions:
  • On an expedition to a barren land that had witnessed volcanic activity, geologists noticed heavy lichen growth on some of the ha
    12·2 answers
  • In blood clotting, the platelets __________ to initiate the clotting process.
    10·2 answers
  • You are a living organism. Which characteristics of life do you exhibit
    10·1 answer
  • A/an __________ is a swelling of clotted blood trapped in the tissues.
    14·1 answer
  • WILL MARK BRAINLY What word do we use to describe the Asexual reproduction of a genetic carbon copy of an animal or plant?
    13·1 answer
  • A RN is caring for a client who is receiving a blood transfusion and develops urticaria one-half hour after the transfusion has
    11·1 answer
  • This is the role of a species in an ecosystem, consisting of such things as what it eats, when it eats, and where it lives.
    6·1 answer
  • List the nitrogen bases that would form the complementary strand: TTCTACCCTACATAGACTCAT
    14·1 answer
  • Yeah, look
    8·2 answers
  • What is measurement ?​
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!