Full question attached
Answer/ Explanation:
The original DNA sequence has a point mutation changing a G to a T. The resulting mRNA produced is always complementary to the DNA from which it is synthesised, so the original mRNA sequence has a T, whereas the mutated mRNA has a U. The tRNA is complementary to the mRNA, so the original has a G, and the mutated has a T.
<h3>Original DNA</h3>
GTTGGCGAATGAACGGAGGCTGACGTCTAAGCCTAGAAAAATTGG
RNA
CAACCGCUUACUUGCCUCCGACUGCAGAUUCGGAUCUUUUUAACC
tRNA
GUUGGCGAAUGAACGGAGGCUGACGUCUAAGCCUAGAAAAAUUGG
<h3>_______________________________________________</h3><h3>Mutated DNA</h3>
GTTGGCGAATGAACTGAGGCTGACGTCTAAGCCTAGAAAAATTGG
RNA
CAACCGCUUACUUGUCUCCGACUGCAGAUUCGGAUCUUUUUAACC
tRNA
GUUGGCGAAUGAACTGAGGCUGACGUCUAAGCCUAGAAAAAUUGG
This is a point mutation called a substitution. This does not affect the entire sequence of the protein, because the mutation is "in frame" meaning the mRNA sequence is still read in the same way by the protein producing machinery. However, it does change the 5th codon from UGC to UGU. If we look up the genetic code, we can see that both of these codons code for cysteine, so there will be no change in the amino acid sequence of the protein
The list that is composed of substances that are widely used for many years without apparent ill effects is the GRAS. GRAS is an abbreviation for generally recognized as safe; it is an American food and drug adminstration designation where chemical or substance added to food is considered safe by experts, and therefore, it is exempted from the usual federal food, drug, and cosmetic Act.
Answer:
<h3>
Qu'est-ce que l'ADN ?</h3>
L'ADN (acide désoxyribonucléique) est un type d'acide nucléique qui se distingue par le stockage de l'information génétique de la grande majorité des êtres vivants. Cette molécule est formée de nucléotides et a généralement la forme d'une double hélice.
Il est nécessaire de prélever des échantillons de certains fluides corporels qui peuvent être du sang, de la salive, des ongles, des cheveux ou du sperme. À l'aide de techniques de laboratoire sophistiquées, l'ADN des échantillons est isolé, puis une cartographie est effectuée, ce qui est fait par des équipements appelés "Séquenceurs d'ADN".
Pour le prouver, normalement le rapport d'un examen ADN apporte quels gènes et chromosomes ont été étudiés et l'analyse du généticien à leur sujet. Les résultats sont présentés dans des rapports simples et clairs. Dans les examens de paternité, le résultat est toujours comparatif.
J'espère t'avoir aidé, bonnes études !
Answer:
Dendrites, cell body, axon hillock, axon, synaptic terminals, biceps brachii.
Explanation:
Neurons are the structural and functional unit of the nervous system. The neurons helps in the transmission of nerve impulse in the body. Two main types of neuron are somatic neuron and motor neuron.
The signal is first reach to dendrites. From the dendrites, the signal transmit to the cell body and then to the axon hillock. The signal then transmits to the axon. At the end of neuron the message is transmitted to the synaptic terminal. The nerve impulse finally reaches to the biceps brachii and results in the flexion of the arm at the elbow.
