1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
sdas [7]
3 years ago
8

SOMEONE HELP WILL GIVE 70 POINTS AND BRAINLIEST. ASAP!!!!!!!!

Biology
1 answer:
schepotkina [342]3 years ago
5 0

Answer:all true except 6 58

Explanation:

You might be interested in
Which of the following statements is NOT true about cellular respiration?
Rashid [163]

Answer:

cellular respiration breaks down sugars and other molecules to use the stored energy

7 0
3 years ago
What structure holds the two sister chromatids together as they prepare for cell division.
otez555 [7]

Two sister chromatids are held together by the centromere

<h3>The Chromosome</h3>

The chromosome consists of 2 sister chromatids that are linked together by a structure known as the centromere.

Each of the sister chromatids carries an allele of the same gene.

The link between the two sister chromatids is broken at the anaphase stage of the cell division when spindle fibers pull them apart towards opposite poles within the cell.

More on the chromosome can be found here: brainly.com/question/296477

5 0
2 years ago
What does the Diagram of the water intake by a Bryophyte look like?
Tatiana [17]
If you want a description of Bryophyte or how it looks like is that:
It is a small green plant that is flowerless and consists of Mosses and Liverworts. It can also be referred as Embrophytes.
5 0
3 years ago
What is the definition of light-dependent reactions and light independent reactions?
PolarNik [594]
<h3>ANS.》i.] Light-Dependent Reaction - In photosynthesis, the light-dependent reactions take place on the thylakoid membranes. The inside of the thylakoid membrane is called the lumen, and outside the thylakoid membrane is the stroma, where the light-independent reactions take place.</h3>

<h3>i.] light independent reactions - The Calvin cycle, light-independent reactions, bio synthetic phase, dark reactions, or photosynthetic carbon reduction cycle of photosynthesis are the chemical reactions that convert carbon dioxide and other compounds into glucose. </h3>

4 0
4 years ago
Questions 1 and 2 refer to the following statements:
melisa1 [442]
I think the DNA crosses the shortening of the


Definition is because the vent of shortness of the following and it says ANB are kind of the same same
5 0
3 years ago
Other questions:
  • If atp accumulates in a cell select one:
    10·1 answer
  • Which statement describes why natural populations cannot keep growing exponentially?
    7·2 answers
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • Bacteria living in the digestive tract of termites digest the cellulose of plant-cell walls, enabling the termite to feed on woo
    11·1 answer
  • Which crustacean lives as an encrusting organism *
    10·1 answer
  • The lac operon in E. coli controls the gene expression of the enzymes that digest lactose in the cell. In the presence of lactos
    14·1 answer
  • You are given a flask with standard liquid media containing a population of S. pombe cells that have a temperature sensitive mut
    12·1 answer
  • The blood vessels that have the smallest diameter and consist of a single layer of simple squamous epithelial
    5·1 answer
  • 3. Which process uses the sun, carbon dioxide, and water to create energy?
    5·2 answers
  • Which organelles are present in plant cells but not in animal cells?.
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!