Answer: Mouth.
Explanation:
The mouth is known to be performing both the tasks of chemical digestion and mechanical digestion.
The food is ingested through mouth and the teeth perform the process of mechanical digestion by breaking down the food particles into smaller particles.
Then the saliva gets mixed into the food and the enzymes(amylase) present in the saliva helps in the digestion of carbohydrates.
So, mouth is the organ that performs the process of both mechanical and chemical digestion.
The answer is letter B. <span>Sporozoa, because it is a disease-causing protozoan
</span>
Sporozoa is a large phylum of parasitic protists that are responsible for many forms of infections, one of which includes PAM.
<span>Thank you for posting your question. I hope you found what you were after. Please feel free to ask me more.</span>
I think the correct answer from the choices listed above is option B. Keratin is the protein in mammals which shows only a primary and secondary structure. Keratin is a fibrous protein forming the structural constituent of hair, feathers, hoofs, claws and many others.
Answer:
(3')CGCGTTATAAAGAGTTTTATAACGCG(5')
Explanation:
<em>The complementary strand is
:</em>
(5')GCGCAATATTTTGAGAAATATTGCGC(3')
<em>The base sequence of the complimentary strand is:</em>
(3')CGCGTTATAAAGAGTTTTATAACGCG(5')
Because this sequence is self-complementary, the individual strands can form hairpin structures. The two strands together may also form a cruciform.
Hairpin structures can be formed by sequences with inverted repeats through two major mechanisms.
- DNA is single stranded in cellular processes such as; during replication on the template for lagging-strand synthesis, bacterial conjugation, natural transformation, and infection by some viruses. Single stranded DNA can fold into secondary structures recognized by proteins, involved in site-specific recombination, transcription, and replication.
- Hairpins can also be formed from double-stranded DNA as a cruciform. A cruciform is a structure consisting of two hairpins extruding through intrastrand base pairing from a palindromic or inverted-reverse sequence.
