1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Y_Kistochka [10]
3 years ago
12

A graph showing the species diversity for a community in response to different levels of disturbance is shown above. Choose all

of
the statements that support the graph.
A) All invasive species have a low impact on the diversity of a community.
B) Intense fires promote more species diversity than fires of low or intermediate intensity.C) Extreme drought and high temperatures will have a small impact on species diversity in the community.
D) A storm of intermediate strength may promote more species diversity than
low and high intensity storms.
E) Selective cutting involving removal of some but not all trees may promote
a higher species diversity in a forest community.

Biology
2 answers:
Gre4nikov [31]3 years ago
8 0

Answer:

D. A storm of intermediate strength may promote more species diversity than

E. Selective cutting involving removal of some but not all trees may promote  a higher species diversity in a forest community.

Y_Kistochka [10]3 years ago
3 0

Answer: D, E

Explanation:

You might be interested in
write an essay about the best meal you’ve ever eaten using all five senses (smell, taste, hearing, touch, sight)
san4es73 [151]

I was sitting in my room, my eyes glued to the flashing screen, the palm of my hands slick with sweat as I struggled to hold onto the controller, the smooth surface slipping every second or so. I could barely hear anything, but the blaring of the sound effects that blasted through my room, shutting out any sound, including the knock on my door from my mother. I started, dropping the controller, my eyes wide. I snapped "What!" at my mother, her face contorting into pinched irritation. "Dinner is ready." She said, turning away to head back down the stairs. My eyes shifted to the open doorway, the nostrils of my nose flaring as I took in the scent of food. I could smell spices, and the humid stench of steam. My stomach growled and I quickly shot up from the floor and thundered down the stairs, leaping into the kitchen to find the source of the heavenly smells that wafted in my direction. I spotted turkey, garnished with lemon and green herbs, and sitting beside it, a large bowl of something off-white. It looked like mashed potatoes. I hastily took a seat and set my elbows upon the wooden surface of the table, my mother scolding me over her shoulder as she divided place settings. "Elbows off, please." She piped, pulling out her own chair with an ear splintering squeal that grated my nerves, causing my teeth to grind together. My mother passed a plate of green beans towards me, and I quickly scooped them onto my own plate, then going for the turkey, the mashed potatoes added last. With no time for prayer, I dug in, the tinges of my fork scraping against the plates clay surface as I scooped a fork full of beans up, and shoved it into my mouth. It tasted bland, with the barest hint of salt. I swallowed, cringing as it went down and took a bite of the mashed potatoes. Of course it was delicious. They were light, buttered perfectly. I gave a small sound of appreciation and went for the turkey last. I stabbed a piece of meat and popped it into my mouth, the texture odd. Hard to describe really. It was tough, but also soft enough to bite into, and with lemon added into it, it was tangy, making my mouth salivate. My mom smiled at the expression my face, nearly laughing. I made a face at her and swallowed, going in for another bite.

6 0
3 years ago
How does a capsule help certain bacteria evade detection by the immune system? How does a capsule help certain bacteria evade de
Anastaziya [24]

Answer:B

Explanation:

8 0
3 years ago
PLS HELP ME WITH THIS!!!<br><br> What is the nucleotide sequence of the mRNA strand you built?
Ad libitum [116K]

Answer:

A DNA strand contains the following nucleotide sequence: TACTGCCTCCCCATAAGAATT

Explanation:

5 0
3 years ago
Read 2 more answers
PLS HELP! WILL GIVE BRAINLIEST
AURORKA [14]

Answer:

70 minutes :  1 hour and 10 minutes

7.6 yards : 22.8 feet

Explanation:

Have a nice day :)

5 0
3 years ago
Δ A boy of 12 years does not take bath regularly and does not use a personal towel after shower. Recently dandruff has increased
Leni [432]
What are the answer choices ?
3 0
3 years ago
Read 2 more answers
Other questions:
  • What is apple plus a banana it's really hard only big brain get it
    6·1 answer
  • In the diagram to the right, identify the three components of a nucleotide. Label A Label B Label C
    7·2 answers
  • How do you think the density of ice affects the survival of water dwelling organisms in environments where temperatures fall bel
    11·1 answer
  • What do you know about an organisms parents if it is heterozygous for a certain trait ?
    10·1 answer
  • How many atoms of nitrogen are in a chemical formula Ni(NO3)2?<br> O 3<br> O 2<br> O 1<br> O 6
    9·2 answers
  • What would be the strand of complementary DNA produced by the strand of DNA shown below? ATG CGA
    8·2 answers
  • Bailey designed a science fair experiment to test the effect of different light sources on the growth of rose plants. To conduct
    9·2 answers
  • A particular species of bacteria has a "a generation time" of 20 minutes. That is, every 20 minutes a single bacterium completes
    11·1 answer
  • Which contains MORE organisms? *<br> A. Genus<br> B. Species<br> C. Phylum
    5·2 answers
  • Which of the following is not a component of natural selection?
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!