1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
muminat
2 years ago
7

Help please ill mark brainliest!

Biology
2 answers:
fgiga [73]2 years ago
5 0

Answer:

<h2>DNA</h2>

Explanation:

<h3>there's my answer hopes it helps you out :)</h3><h3>have a great day</h3>
AysviL [449]2 years ago
3 0
DNAAAAAAAAAAAAA your welcome
You might be interested in
What structures are present in plant and animals cells but not in bacterial cell
tatiyna

Answer:

organelles such as nuclei, mitochondria or chloroplast

6 0
2 years ago
Four hundred beetles of the same species were sprayed with an insecticide. Several weeks later, nearly all the beetles were dead
Kamila [148]

Answer:

D

Explanation:

Just trust me.  

it's not A because there's no such thing as favorable traits whenever it comes to incesticide and for B the majority of Beatles and future generations will also die that's only to the ones that died but that can not happen, which means that D is the one that will be the correct answer because if one lives, then the rest of the generations live due to immunity in the generation that started it.  

5 0
2 years ago
Read 2 more answers
Fats are a primary example of which class of biomolecule? *
dedylja [7]

Answer:

Lipids

Explanation:

Lipds are fats

Have a good day

Give me brainiest if possible

6 0
3 years ago
25. Review the graph below. Blue Jays and Robins do not interbreed. Assuming that both birds live in the same habitat, what woul
kolbaska11 [484]
We do quite often have mutt birds. (the correct name for such a mutt is a hybrid. <span>They are way more common than most people think, but unless you are a birdwatcher you probably wouldn’t even spot them. People often see an odd looking birds and simply think it’s a type they haven’t seen before, when in fact it is a hybrid of two well-known species. 

Having said that, for birds to hybridized they have to be fairly closely related to start with. Robins and blue jays are no more closely related than humans are to baboons. You wouldn’t expect a human and a baboon to be able to mate and produce babies would you? So no, robins and blue jays can’t interbreed.

However there are many different species of animal that CAN interbreed and produce offspring. But the different species need to be fairly closely related, far more closely than human and baboon… or a blue jay and a robin.

For example we can interbreed horses and donkeys to produce baby mules, and we can breed cattle and buffalo, or camels and llamas. And the same is true of birds. While blue jays can’t be bred with robins in the wild we quite frequently find mutt birds.

<span> Ducks are particularly noted for forming wild mutts and many if not all north American mallards for example are of mixed species ancestry.</span>


</span>
5 0
3 years ago
Water rushes into the plant cells vacuole is it diffusion or osmosis
77julia77 [94]
Osmosis in the cell vacuole because the difference of concentrations
outside / inside the cell
6 0
3 years ago
Other questions:
  • How does a placenta form?
    14·1 answer
  • If the phenotype of pea pod color is determined by incomplete dominance and the combination of an allele for yellow seeds and an
    11·1 answer
  • Amino acids for- GACAAUGAAAGUUAGCAUGUGGUUGUGACGAAAG
    8·1 answer
  • If individual 1 in generation had the same phenotype as his wife ,what are the chances that There children would have rickets
    7·1 answer
  • Biological scientists use a variety of methods to gather evidence, or data. If a biologist makes a diorama of a plant cell, what
    9·1 answer
  • How many electrons are in this atom?<br> А. 13<br> в. 20<br> с. 7<br> D. 6
    5·2 answers
  • Lipids are soluble in solvents called ___
    10·1 answer
  • Why is the sequence of amino acids important to protein function?
    14·1 answer
  • The graph below shows the averaged sunspots from 1610 to 2007. The graph shows sunspot number on the y axis and years 1600, 1650
    8·2 answers
  • Why would rapid change in climate potentially lead to ecological problems?
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!