1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
muminat
3 years ago
7

Help please ill mark brainliest!

Biology
2 answers:
fgiga [73]3 years ago
5 0

Answer:

<h2>DNA</h2>

Explanation:

<h3>there's my answer hopes it helps you out :)</h3><h3>have a great day</h3>
AysviL [449]3 years ago
3 0
DNAAAAAAAAAAAAA your welcome
You might be interested in
Use what you know about the number of faces, vertices, and edges in polyhedrons to choose True or False for each statement.
inn [45]

Explanation:

1. A true statement

2. A false statement

3.A true statement

4.A true statement

3 0
3 years ago
What are at least two characteristics of RNA?
NeTakaya

Answer:

Present at nucleus and cytoplasm

3 0
3 years ago
Read 2 more answers
AUUUAACUGUUCUGUCUAGAG
Lana71 [14]

Answer: three sets: ile. leu,phe,cys,leu,glu. glu,ile,cys,leu,val,asp,leu

The most likely sequence to be included is the R to L read, because of the STOP codon if read L to R. The lone ile would be the last amino acid of a different polypeptide, and there is no promoter sequence after the STOP codon.

Explanation:

auu,uaa,cug,uuc,ugu,cua,gag

Ile,STOP,leu,phe,cys,leu,glu

glu,ile,cys,leu,val,asp,leu (reverse)

After a STOP codon, a DNA promoter is required

5 0
3 years ago
Which of the following statements are TRUE about rain falling from clouds?
puteri [66]

Answer:

one and four

Explanation:

4 0
3 years ago
Read 2 more answers
After running 45 meters, how far is she from the beginning of the track
yan [13]
45 meters I’m guessing is she ran 45 meters
4 0
3 years ago
Read 2 more answers
Other questions:
  • This type of joint allows the greatest range of motion. *
    13·1 answer
  • What is a river basin?
    15·2 answers
  • Which is the result of an object's motion?.
    12·1 answer
  • 1.Which bright solar feature is shown in the picture above?
    15·2 answers
  • Student who is calculating the average mass of plastic bags placed in a landfill each year is:
    7·1 answer
  • Please help me as soon as possible
    6·1 answer
  • If old mountains wear down over the course of millions of years, what is one of the primary reasons that mountains still exist?
    13·1 answer
  • Explain the gaseous exchange in lungs
    5·2 answers
  • Select which statements are a part of natural selection.
    10·2 answers
  • MARK YOU THE BRAINLIEST!<br> What make a Weeping Willow a eukaryotic cells give three reason why ?
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!