1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Paladinen [302]
3 years ago
12

2. A living disease carrier is called a: *

Biology
1 answer:
adoni [48]3 years ago
7 0

Explanation:

As I think vector is the correct one.

You might be interested in
You see a high proportion of winged individuals in a population of the bean aphid. the most likely explanation is that
tiny-mole [99]

The most likely explanation of as to why there is a high proportion of winged individuals in a population of bean aphid was because there is a presence of high population density or another reason is that there is already a high population if before the aphids develop or has developed.

8 0
3 years ago
If mongoose were removed from this simple food chain, what effect would that have on the snakes?
sweet [91]

Answer: they would be dead

Explanation:

7 0
3 years ago
Read 2 more answers
Skin provides protection from infection by
notka56 [123]

Answer: Option A) secreting antibodies from eccrine glands

Explanation:

The eccrine glands, a type of sweat gland found in the deep layer of the skin provides protection from infection by producing sweat that is majorly composed of water, but also immunoglobins.

These immunoglobins are designed to respond to foreign and potentially harmful pathogens, removing them and protecting the body.

Thus, the answer is secreting antibodies from eccrine glands

8 0
3 years ago
Read 2 more answers
Which of the following can help correlate rock formations?
love history [14]
Similar rock types......................................
7 0
3 years ago
Read 2 more answers
The particles in solid matter are very close. true or false​
netineya [11]

Answer:

true

Explanation:

6 0
3 years ago
Read 2 more answers
Other questions:
  • Make a recommendation, how the loss of producers can affect the other organisms and how you can prevent it from happening?
    14·1 answer
  • A segment of DNA has been transcribed into RNA. The base sequence of the RNA segment is AACGCUAUU.
    14·1 answer
  • 3. What adaptation of land plants helps it to control gas exchange with the atmosphere?
    10·1 answer
  • The mass of a proton is equal to the mass of the neutron. What is the atomic mass of an atom ? Group of answer choices number of
    7·1 answer
  • Base Sequence of Complementary DNA Strands One strand of a double-helical DNA has the sequence (59)GCGCAATATTTCTCAAAATATTGCGC(39
    6·1 answer
  • Need help:)) will mark brainliest if right! i need help explaining too
    15·1 answer
  • Most of the training of animals is learned from
    14·1 answer
  • Hurricane katrina was a catastrophe,contributing to the problem was subsiding of the region from 3 to 12 feet per 100 years.Whic
    5·1 answer
  • Help please, I want the answer
    7·1 answer
  • Which of the following best explain why earthquakes occur?
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!