1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
sergey [27]
3 years ago
14

Teeheeteeheeteeheeteeheeteeheeteehee teehee teehee teehee teehee teehee

Biology
2 answers:
gavmur [86]3 years ago
4 0

Answer:

lol

Explanation:

mylen [45]3 years ago
3 0
Mmmhmmm ok?????? Lolll
You might be interested in
Why is nuclear energy considered to be a nonrenewable energy resource
puteri [66]
Nuclear power plants have a rare type of uranium and uranium is a non renewable resource
7 0
3 years ago
Which event produces a covalent bond?
goblinko [34]
Sharing  value electrons
4 0
3 years ago
Read 2 more answers
Answer #7 and will mark brainliest
Basile [38]

Answer:

the fact that the bubbles of carbon are bursting due to the high amount of drilling recently

Explanation:

3 0
3 years ago
What is the shape of a drop of water?
Shalnov [3]
If the drop is small enough, it is a perfect sphere.
<span> A sphere is the geometrical shape that has the smallest surface area for its volume. The drop takes this shape because water molecules tend to stick to each other. So, when not confined by a container, and with nothing around it to distort its shape, a very tiny water drop is perfectly round like a ball because the water molecules are pulling inward toward each other. </span>

<span>If the drop is larger like a raindrop in free-fall, it has a domed top and a semi-flattened bottom because as it falls it must push the air out of its way. That "upward" push of the air being displaced causes the falling drop to have a rather flattened bottom. </span>

<span>Contrary to popular misconception, a free-falling raindrop is not shaped like a teardrop -- round on the bottom and pointy on top.

From:</span>https://www.quora.com/When-a-water-drop-falls-does-it-form-a-circular-shape
7 0
3 years ago
What is not true about anaerobic respiration?
jasenka [17]
It uses a little oxygen - it uses none
8 0
3 years ago
Other questions:
  • Which term defines a well tested,scientifically supported statement that explains how something works
    13·1 answer
  • Hat is the difference between DNA and RNA?
    11·2 answers
  • How does the immune system know if a foreign particle has infected the body?
    10·1 answer
  • A group of 250 women over the age of 40 are recruited for a study to determine the effects that calcium has on bone health. Half
    5·1 answer
  • How much ug of protein are we suppose to load on sds precast gel?
    15·1 answer
  • In Drosophila, the genes for body coloration and eye size are on different chromosomes. Normal-colored bodies are dominant to eb
    10·2 answers
  • The SRY gene:________.
    7·2 answers
  • 1-5 For the following DNA sequences, replicate the DNA<br> 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC
    13·1 answer
  • A cell with only one set of chromosomes is called [ diploid or haploid ] cell.
    12·1 answer
  • WILL MARK BRANLIEST PLS HELP
    15·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!