1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
AURORKA [14]
3 years ago
9

What is a consumer????????????????

Biology
1 answer:
gtnhenbr [62]3 years ago
3 0

Answer:

a person who purchases goods and services for personal use.

Explanation:

You might be interested in
Vitamin A deficiency is most common damaging to which of the following populations is
yaroslaw [1]

<u><em>hello,</em></u>

<u><em>Vitamin A deficiency</em></u> can cause both temporary and permanent eye damage, and may even lead to blindness. In fact, vitamin A deficiency is the world's leading cause of blindness.<em>Vitamin is most damaging to women,preganant women and increase mortality function.</em>

<em>thanxxxx</em>

<em>heyyya</em>

<em>mark as brainlisttt</em>

6 0
3 years ago
Why would farmers plant alfalfa that has less economic value
arlik [135]

answer:

because it benefits the soil. the long alfalfa stand life also gives the soil a chance to rest from frequent field crop rotations, helps provide nitrogen for subsequent crops, and improves soil tilth. this helps prevent pesticide and sediment movement to natural waterways.

good luck :)

hopefully, this helps

have a great day !!

8 0
3 years ago
The _____ is the main means for transmitting messages between the brain and the body.
kiruha [24]

The correct answer is d. spinal cord.

Spinal cord is a bundle of neurons which starts from the brain and runs down the entire length of the back of the body. The spinal cord acts as a main means to transmit the messages between the brain and the body.

Sensory or efferent neurons carry the information from the perimeter of the body and pass to the central nervous system whereas the motor or efferent neurons act as a communication channel and carry the information from the nervous system to various glands and muscles.

8 0
4 years ago
Read 2 more answers
Think of your community. What is the land<br> used for in Orlando?
Aneli [31]
Land use is when an area is used for a specific purpose. There are five types of land use: residential, agricultural, recreation, transportation, and commercial.
8 0
3 years ago
Is a gene that can be masked by dominant gene
ruslelena [56]

Answer:

i believe the answer is recessive.

Explanation:

a recessive gene can be expressed as rr instead of RR so if one does a punnet square it would show up to be Rr Rr Rr Rr, since R represents a  dominant  trait and r being being recessive, then the answer would be recessive. (sorry if it doesn't really make any sense)

7 0
3 years ago
Read 2 more answers
Other questions:
  • Am i correct can someone help me the the picture above
    15·1 answer
  • Is the clavicle inferior the contralateral?
    5·1 answer
  • Explain the impact on the cell cycle of a proto-oncogene versus an oncogene.
    10·1 answer
  • Why do people tend to cup their hands around listeners' ears when whispering to them?
    9·2 answers
  • Difference in prophase one and prophase two in meiosis
    9·1 answer
  • Match each term with the correct definition.
    13·1 answer
  • What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3'
    8·1 answer
  • Steroid hormones bind to receptors in the nucleus of their target cells. cannot diffuse through cell membranes. remain in circul
    11·1 answer
  • What is the effect of growth hormone on metabolism? Pay special attention to its effect on protein, bone, fatty tissue, and carb
    9·2 answers
  • Bacteria convert nitrogen gas from the atmosphere into nitrates which are
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!