hydrophobic tail and hydrophilic head.
Hi there!
In the experiment we can identify the variables to determine if the result of the experiment is sound.
Dependent variable - Growth of plants
Independent variable(s) - Medium of watering, being talked to and not talked to
In an experiment you want to have 1 independent variable to determine if that 1 variable is influencing the dependent variable. Because there are two independent variables in this experiment, it is impossible to tell which one caused the plants that were talked to to grow more. As a result, the correct answer would be...
B. Talking to plants may or may not help plants grow faster because the amount of water given was likely different for each group.
Answer:
No.
Explanation:
Based on the punnets square (assuming that eye color is a one gene trait in this question) There is a 75% chance they would have a child with brown eyes and a 25% chance that the child would have blue if the father is heterozygous. Theoretically the father could be heterozygous and still have 11 brown eyed kids. This just means that the Dad always passed down his dominant gene.
Q1)
the sequence given, we need to read from 5' to 3' and find where the reading frame starts. That's where atg is found.
<span>5’ agcggg atg agcgcatgtggcgcataactg3’
from here onwards we have to separate the bases into groups of three as these are codons that each code for an amino acid.
</span><span>5’ agcggg atg agc gca tgt ggc gca taa ctg 3’
Met Ser Ala Cys Gly Ala stop
TAA(UAA in mRNA ) is the stop codon so reading frame stops here
we change base A to T (capitalised)
DNA sequence with amino acids are given
</span>5’ agcggg atg Tgc gca tgt ggc gca taa ctg 3’
N Met Cys Ala Cys Gly Ala stop
after changing the base the amino acid sequence changes from Ser to Cys.
Q2)
the complementary strand of the above strand is as follows <span>
5' cagttatgcgccacatgcgctcatcccgct 3'
start codon starts with atg thats where the reading frame starts
</span>5' cagtt atg cgc cac atg cgc tca tcc cgc t 3'
Met Arg His Met Arg Ser Ser Arg
After changing base from A to T, the complementary strand changes from T to A (capitalised)
5' cagtt atg cgc cac atg cgc Aca tcc cgc t 3'
Met Arg His Met Arg Thr Ser Arg
amino acid changes from Ser to Thr.
Q3)
The sequence with amino acids before inserting a base is
5’ agcggg atg agc gca tgt ggc gca taa ctg 3’
Met Ser Ala Cys Gly Ala stop
We insert a base G shown in capitals
5’ agcggg atg agc Ggca tgt ggc gca taa ctg 3’
This changes the codons of bases after the inserted base
5’ agcggg atg agc ggc atg tgg cgc ata act g 3’
Met Ser Gly Met Trp Arg Ile Thr
the amino acid completely changes from Met Ser Ala Cys Gly Ala
to Met Ser Gly Met Trp Arg Ile Thr
Q4)
the complementary strand before adding a base is
5' cagtt atg cgc cac atg cgc tca tcc cgc t 3'
Met Arg His Met Arg Ser Ser Arg
When we insert a base G, base C is added to the complementary strand
5' cagtt atg cgc cac atg cCgc tca tcc cgc t 3'
this changes the codons
5' cagtt atg cgc cac atg cCg ctc atc ccg ct 3'
Met Arg His Met Pro Leu Ile Pro
With insertion of one base the amino acid sequence changes from
Met Arg His Met Arg Ser Ser Arg
to Met Arg His Met Pro Leu Ile Pro
Answer:
The last time levels of atmospheric carbon dioxide were this high came during the Pliocene Epoch, which extended from about 5.3 million to 2.6 million years ago.
Explanation:
