1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
slavikrds [6]
3 years ago
12

Which two organisms in the chart below are most similar in genetic composition?

Biology
2 answers:
Dima020 [189]3 years ago
6 0
A and d. Pretty sure
Lelu [443]3 years ago
5 0
A and D are the most similar in genetic composition
You might be interested in
How can the ethiopian wolves prey be classified as.<br><br> Dont say endangered plz
TEA [102]

Given what we know about the diet of the Ethiopian wolves, we can confirm that their prey can be classified as rodents.

<h3>What are Ethiopian wolves?</h3>
  • The Ethiopian wolves are a canine native to Ethiopia.
  • They are carnivores and hunt in packs.
  • Despite their name, they more closely resemble foxes or jackals.
  • They feed on rodents such as rats and hares.

Therefore, given their diet based primarily on animals such as hares, giant mole rats, and grass rats, we can confirm that the prey of the Ethiopian wolves can be classified as rodents.

To learn more about Ethiopia visit:

brainly.com/question/1267380?referrer=searchResults

4 0
2 years ago
Need Answer ASAP. Why do disruptive selection pressures tend to favor rapid evolutionary changes?
lawyer [7]

Answer:

A .They result in sudden gene frequency changes.

Explanation:

5 0
3 years ago
Many pharmaceutical drugs specifically inhibit transcription in bacteria but not archaea or eukarya. why would drugs that inhibi
netineya [11]
Eu means true therefore it is known as eubacteria
5 0
3 years ago
What is a qualitative observation?
ad-work [718]

Answer:

A qualitative observation involves the use of five sensory organs, sight, smell, taste, touch, and hearing, and their function to examine the attributes. Being subjective in nature, it focuses on the characteristics and qualities of the variables rather than the numerical value.

Explanation:

mark as a brainliest answer if it helps you

6 0
2 years ago
Read 2 more answers
PLEASE HELPPP
xenn [34]

Answer: B- Cell division

Explanation:

5 0
3 years ago
Read 2 more answers
Other questions:
  • I need help fast in this question I keep getting it wrong
    11·1 answer
  • What is called the "building block" of<br> life?<br> )))<br> atom<br> organism
    7·1 answer
  • I need help fast!!
    12·2 answers
  • Which treatment would most likely be used for cardiovascular disease?
    14·2 answers
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • the inability of a sperm cells to move normally could prevent the production of offspring by interfering with
    13·1 answer
  • You find a previously unknown single-celled organism in a water sample. while studying it, you find that the organism is photosy
    12·1 answer
  • There are two main ways in which molecules are transported into and out of cells, active transport and passive transport. Which
    7·2 answers
  • Where geothermal resources are located and how we recover them
    13·1 answer
  • The neurotransmitter acetylcholine
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!