1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
otez555 [7]
3 years ago
8

If a business that sells gidgits files for bankruptcy to liquidate all of its assets in order to repay its creditors, it is goin

g to file a Chapter 11 reorganization.
True
False​
Law
2 answers:
andre [41]3 years ago
6 0

Answer:true

Explanation:

neonofarm [45]3 years ago
3 0

Answer:

False, I'm pretty sure.

Explanation:

A Chapter 11 bankruptcy doesn't involve the business liquidating all of its assets; the business continues to operate and the debts are just reorganized. If they want to liquidate all of their assets, they should file a Chapter 7 bankruptcy, which is a lot less expensive anyway.

You might be interested in
Plzz help
borishaifa [10]

Answer:

Not only has she started drinking copious amounts of alcohol, but she's also started smoking excessively

7 0
3 years ago
When did everybody wants to rule the world come out.
kap26 [50]
Everybody wants to rule the world January 1 1985
3 0
2 years ago
How many repeats are there for this STR? Refer to the following DNA sequence to answer the questions: CTAGAAGCTTAAAGCTTCATCATCAT
andreyandreev [35.5K]

Answer:

The number of repeats within an STR is referred to as an allele. For instance, the STR known as D7S820, found on chromosome 7, contains between 5 and 16 repeats of GATA. Therefore, there are 12 different alleles possible for the D7S820 STR.

7 0
3 years ago
Okay so I'm 18 and I still live under my parents roof but they won't let me have a phone, is it weird that they do this to me?..
Semmy [17]

Answer:

yes it's weird

Explanation:

maybe you should get a job, I know it sound's weird but think about it, your parents will think of you as more responsible, and you can start saving up for a phone, if you buy it with your own money, they can't really take it legally considering that you are now considered an adult (if you live in the U.S.). From what you said it seems like your still in high school, so also try and focus on maintaining a high GPA and doing well on the SAT if you have not taken it already, to get into college, once you're in college you don't have to see your parents unless you want to.

hope that helps

8 0
2 years ago
Read 2 more answers
5. Elijah and Ava are in a warehouse store with their mother. They see several tables with samples of food on them. Elijah takes
Alenkasestr [34]

Answer:

From how the both of them reacted I have a feeling Ava is older. If I'm correct Elijah still doesn't have much common sense and he would be confused on why taking more than one sample is an issue.

Explanation:

5 0
3 years ago
Other questions:
  • Needs of victims after they been labor trafficked
    7·1 answer
  • What was one major weakness of the Articles of Confederation?
    5·1 answer
  • Describe the difference between a voluntary and involuntary placement.
    13·2 answers
  • Critical Thinking: Write a short, persuasive paragraph convincing a foreign visitor the value of having a limited government.
    15·1 answer
  • Without paying interest for a late bill, if the $5,543 has to be paid in 12 payments over the next year, how much will they need
    8·1 answer
  • A 5-year corporate bond yields 9%. A 5-year municipal bond of equal risk yields 6.5%. Assume that the state tax rate is zero. At
    10·1 answer
  • Which agency requires a college degree for employment?
    12·1 answer
  • If you live on the border of Trenton and Pennsylvania does common in law apply?
    8·1 answer
  • How does alcohol have a side affect
    9·1 answer
  • T/F Most asset forfeiture laws allow the government to confiscate any and all property used in the commission of the certain cri
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!