English: He crossed borders between West- and East-Germany, academic disciplines (history, cartography, economy), and different fields when he published a historical atlas (Synchronoptical World History, 1952 ff.), drafted maps (Peters-projection, 1974 ff.) and designed (but never realized) a so-called ‘Synchronoptikum’ (mid-1960s to mid-1990s). Although he never wrote or published a classical historical work nor left an opus, his contemporaries called him a polyhistor. In brief, Peters’ aim was the equal representation of time and space in history and geography. He was vehement in his criticism of the Europe-centred character and constant use of the Mercator-projection. Peters was a critic of the historical focus on the last 500 years of world history as well as its concentration on western civilizations and on politics. Both maps and history books mislead readers to accept Europe and Western civilizations as the history’s core, thus leading to ignorance of 90% of world history and the majority of people living in the Southern hemisphere. Later he dealt with economics and developed a concept of a democratic economy, based on an equivalent exchange of goods. He identified modern societies with market economies as non-equivalent economies. The concept of equal representation of goods came high on Peters’ agenda, after time and space. This article reviews the fields of Peters’ work, explicates his idea of world history and gives a biographical sketch. While the Peters-projection has widely been discussed and criticized, the article focuses on the un-translated Synchronoptical World History, which reminds us of the 18th century synchronistic tables. The design of a building (Synchronoptikum) resembling a panorama museum, characterized Peters as crossing the border between history as academic discipline and social intervention. Spanish:
Cruzó las fronteras entre Alemania Occidental y Oriental, disciplinas académicas (historia, cartografía, economía) y diferentes campos cuando publicó un atlas histórico (Synchronoptical World History, 1952 ff.), Redactó mapas (Peters-projection, 1974 ff. ) y diseñó (pero nunca se dio cuenta) de un llamado 'Synchronoptikum' (mediados de la década de 1960 hasta mediados de la de 1990). Aunque nunca escribió ni publicó una obra histórica clásica ni dejó una obra, sus contemporáneos lo llamaron polihistor. En resumen, el objetivo de Peters era la representación equitativa del tiempo y el espacio en la historia y la geografía. Fue vehemente en su crítica del carácter centrado en Europa y el uso constante de la proyección de Mercator. Peters fue un crítico del enfoque histórico en los últimos 500 años de la historia mundial, así como su concentración en las civilizaciones occidentales y en la política. Tanto los mapas como los libros de historia inducen a error a los lectores a aceptar a Europa y las civilizaciones occidentales como el núcleo de la historia, lo que conduce a la ignorancia del 90% de la historia mundial y de la mayoría de las personas que viven en el hemisferio sur. Posteriormente se ocupó de la economía y desarrolló un concepto de economía democrática, basado en un intercambio equivalente de bienes. Identificó las sociedades modernas con economías de mercado como economías no equivalentes. El concepto de representación equitativa de los bienes ocupó un lugar destacado en la agenda de Peters, después del tiempo y el espacio. Este artículo revisa los campos del trabajo de Peters, explica su idea de la historia del mundo y ofrece un bosquejo biográfico. Si bien la proyección de Peters ha sido ampliamente discutida y criticada, el artículo se centra en la Historia mundial sincrónica sin traducir, que nos recuerda las tablas sincrónicas del siglo XVIII. El diseño de un edificio (Synchronoptikum) parecido a un museo panorámico, caracterizó a Peters como cruzar la frontera entre la historia como disciplina académica y la intervención social.
First of all you need to know that DNA is formed by nitrogenous bases represented by letters (ATCG). The sequence that these letters present in the DNA are the basis for the establishment of the processes of replication, transition and translation. This is because these bases complement each other and make connections between themselves as follows:
Adenine (A) is complementary and makes connections with Timine (T) in DNA and with Uracil (U) in DNA and vice versa.
Guanine (G) connects and is complemented by cytosine (C) and vice versa.
Based on that, we can use the sequence 5'TATAATGAAGTTCCGAGGATAG-3 as a model for DNA replication we can say that the sequence of the new DNA strand would be 3 'ATATTACTTCAAGGCTCCTATC 5', since the new strand is built based on the complementarity of the bases nitrogenous.
This same sequence, when used in replication, for the formation of an RNA molecule, would also use the base complementarity, forming an RNA molecule with the sequence 3 'AUAUUACUUCAAGGCUCCUAUC 5'.
The translation, in turn, would use the RNA sequence to form the amino acids that would form a protein. Each amino acid would be formed by the joining of three nitrogenous bases of the RNA sequence, thus the protein would be formed by the amino acids AUA UUA CUU CAA GGC UCC UAU
The amount of sunlight changes when moving between north and south.
Explanation:
Climate change results from global warming which is an increase in the temperature of the earth.
The sun is the primary source of temperature change on earth, and latitude place a great role in the amount of sunshine that come to an area. Places at high latitude receive less sunlight when compared to places at low latitude, this in turn determines how warm or cold a region can be. On the other when moving from east to west, it is along longitudinal lines and this can be on same elevation, thus there are no significant changes in temperature.
Therefore sunlight plays a key role in altering the temperature along latitudes.
This is where production, investment and prices are all controlled and determined by the government. Command Economies are not controlled by free market. The Government decides how much a product should cost and what price they should be put for sale as.
Market Economies:
This is where the product prices and value are determined by the product keeper and/or seller. The seller decides how much they want to sell it for, not the Government. This also comes with supply and demand. Prices can increase or decrease as the seller wishes.
Tradition Economies:
This is where the economy relies on customs and history. They go by what has been done in the past and what has worked out before. Traditional Economies depend on farming, agriculture, fishing, and natural sources.
