Answer: f
Explanation: the uterus is where the fetus is located I’m pretty sure hope this helps :)
I believe the answer is 1/2
The part anti means opposed. Biotic is basically all the naturally occurring organisms. So an antibiotic would oppose an organism like a virus.
Answer:
First, you must know what the stop codons are: UAA, UAG, and UGA
Whenever this sequence is read, it signals for an end in transcription and amino acids will stop being formed
Thus, 5′−GGCCCUUUUAGGGCCUUUUU−3′ contains a cue for transcription termination as it will stop after the codon "UAG"
Explanation:
The answer would be Neurotransmitters
hope that helps