1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Lera25 [3.4K]
3 years ago
13

In order for a cell to remove waste, those materials must pass through which cell structure? A. chromosomes B. mitochondria C. c

hloroplasts D. cell membrane
Biology
1 answer:
Zepler [3.9K]3 years ago
8 0

Answer:

d

Explanation:

You might be interested in
2. Which of the following do all animals not need to do in order to survive.
laila [671]
I think the answer is Eliminates waste
7 0
3 years ago
I WILL MARK YOU BRAINLIEST IF YOU ANSWER THIS.
Artist 52 [7]

Answer:cell is the basic unit of life.

A cell may be unicellular or multicellular

Explanation:

7 0
2 years ago
Read 2 more answers
A cage
raketka [301]
I think it’s B I’m not sure
7 0
4 years ago
If a dominant allele of one gene, a, is necessary for hearing in humans, and the dominant allele of another gene, b, results in
yKpoI14uk [10]
The correct genotypes of the parents are <span>AaBb and Aabb

In a cross of these two genotypes presented in the image below, 5/8 of the offspring would be deaf.
The individuals marked with a red square would be deaf because of the recessive aa alleles and the rest of the progeny that is marked with green would be deaf because of the presence of the B dominant allele.</span>

6 0
4 years ago
Primary and secondary air pollutants can co-exist in the atmosphere.<br> a. True<br> b. False
Neporo4naja [7]
I believe this is A, true.
4 0
3 years ago
Read 2 more answers
Other questions:
  • Que significa la expresión : "tener una efectividad del 99%"
    15·1 answer
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • In which of the following situations is salinity highest?
    8·2 answers
  • What happens to the frequency heard when an observer begins moving toward the stationary source of a sound?
    10·2 answers
  • : Which two of the following features are determined by the length of a gene and its particular sequence of As, Cs, Gs and Ts?
    11·1 answer
  • Which structure is responsible for allowing material into and out of an animal cell?
    6·1 answer
  • Which of the following is NOT one of the key characteristics of a well-designed test?
    5·1 answer
  • Emperor penguins are specialized birds
    11·1 answer
  • Describe the 10 disorders that result from the description of homeostasis​
    13·1 answer
  • Please help me on this its due now​
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!