1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
lisabon 2012 [21]
3 years ago
6

Copies of chromosomes are called____

Biology
1 answer:
zloy xaker [14]3 years ago
3 0

Answer:

option 2

Explanation:

because there divide

You might be interested in
What does cyclical mean
Kryger [21]
Cyclical means occurring in cycles technically meaning reoccurring.
3 0
3 years ago
The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
olchik [2.2K]

Answer:

According to the  number of sequence on DNA  there should be 10 amino acid. But after 7 amino acid there is stop codon so only 7 amino acid can be synthesized.

Explanation:

DNA sequence given here is CCTACCTTATGCCAAGTTGGGGATAAACTC it is read from left to right. When this DNA is transcribed mRNA sequence will be-

GGAUGGAAUACGGUUCAACCCCUAUUUGAG. These 30 nucleotide will synthesize following amino acids-

GAG  UUU  AUC  CCC  AAC  UUG  GCA  UAA  GGU  AGG-

Glutamine,  Phenylalanine,  Isoleusine,  Proline, Asparagine ,   Leucine,  Alanine,   stop codon.  As ribosome reach on stop codon protein synthesis stopped and process aborted.

8 0
3 years ago
Denaturing a proteins causes a change in the shape of an enzyme. *<br> True or<br> False
Katen [24]

Answer:

True

Explanation:

Denaturing is a process in which protein looses its shape. Due to loss of shape (structure), protein also looses its function. This change in shape is due to change in temperature or pH of the protein.

Due to high temperature the shape of active site gets distorted due to which it becomes non functional. Change in active site of enzyme will  change shape of the enzyme and make it unfit for the substrate/reaction.

7 0
3 years ago
it requires 12 hours to fill 3/5 of a swimming pool at this rate how many hours is required to fill the remainder pool
emmasim [6.3K]
So if you take the 12 hours that it takes to fill the swimming pool 3/5 way then u divide 12 by 3 and you would get 4 which would mean each quarter took 4 hours then it would take 8 more hours to fill the rest of the swimming pool
6 0
3 years ago
A nonpregnant woman requires 46 grams of protein per day. how many grams per day would she need if she became pregnant?
Andreyy89
According to the American Pregnancy Asociation, pregnant woman shall eat 75 to 100 grams of protein per day.

Hope it helps!
8 0
3 years ago
Other questions:
  • Releasing hormones originate in which part of the brain
    14·1 answer
  • Help me on this plz eviromental science
    12·2 answers
  • Which positions in the Law, Public Safety, and Security fields require a certification or license to perform?
    5·1 answer
  • In addition to phospholipids, which of the following organic molecules are also a part of cellular membranes?
    9·1 answer
  • How is mitosis different in plants and animals?
    13·2 answers
  • What are population pyramids? How do they help in understanding about the population of a country? (​
    5·1 answer
  • AaNnanNnanNnBhBhELPPPPPPP HELPPPPP
    14·1 answer
  • Mom has type A blood and Dad has type B blood. Their first child had type o blood and they think the hospital might have messed
    9·1 answer
  • What are the only things that can change in a valid experiment? A. Control variable and Range B. Independent variable and Hypoth
    12·1 answer
  • Can you identify the characteristics of plants that typically grow in early and late stages of secondary succession in an abando
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!