1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
tatuchka [14]
3 years ago
11

A white chicken with black spots is a result of

Biology
2 answers:
adell [148]3 years ago
8 0

Answer: A

Explanation:

KengaRu [80]3 years ago
3 0

Answer:

b

Explanation:

you can already get rid of d and c because you know that it has something to do with combining the 2 alleles. Incomplete dominance is when the 2 colors blend together to make another color, like a red and white flowers offspring is pink. codominance is when both alleles are shown, just like the black spots on the chicken. your answer is b!!

have a good night!

You might be interested in
Amino acids for- GACAAUGAAAGUUAGCAUGUGGUUGUGACGAAAG
trapecia [35]

Answer:

idk

Explanation:

im very sorry about this but i dont know the answer

7 0
3 years ago
Identify the chemical and physical changes 1)photosynthesis
Neko [114]

Answer is 3 it uses chemical and physical changes when using stomach acid and physical when turning food in your stomach.

3 0
2 years ago
Read 2 more answers
Explain Why ice stays on top of oceans instead of sinking to the bottom.
Mariana [72]

The ice stays on top because it is sold which means it is less dense than liquid (water)

5 0
3 years ago
What are the parts of the lipid?
Svetllana [295]
Lipids/Fats have glycerol in addition to three fatty acids. The structure of the fatty acids determines whether or not the fat is considered saturated or unsaturated. Phospholipids have four major components: fatty acids, a glycerol component, and both a phosphate group and a polar molecule
Hoped this helped !
7 0
3 years ago
If you need help friend me 4th-7th grade
marin [14]

Answer:

okay

Explanation:

just want your help

5 0
3 years ago
Other questions:
  • A formal decision by a governing body is known as a(n) ___________. A. amendment B. resolution C. catayst D. contingent Please s
    6·2 answers
  • How can we represent the weather conditions on a station model?
    13·1 answer
  • Definition of osmosis in terms of isotonic, hypertonic, hypotonic biology
    15·1 answer
  • What muscles is important in controlling breathing?
    6·2 answers
  • Organisms use energy for all chemical processes. together, all of these processes are called
    14·1 answer
  • How do you do reproduction
    8·2 answers
  • Use the graph to answer question 1.
    11·1 answer
  • GCGAATTGC<br> Which of the following mRNA strands would be synthesized from the DNA strand above?
    14·2 answers
  • What is your relationship between matter and energy in an ecosystem ?
    10·2 answers
  • What are organic compounds
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!