Quaternary consumers eat the tertiary consumers and are carnivores.
The translocon (commonly known as a translocator or translocation channel) is a complex of proteins associated with the translocation of polypeptides across membranes.[1] In eukaryotes the term translocon most commonly refers to the complex that transports nascent polypeptides with a targeting signal sequence into the interior (cisternal or lumenal) space of the endoplasmic reticulum (ER) from the cytosol. This translocation process requires the protein to cross a hydrophobic lipid bilayer. The same complex is also used to integrate nascent proteins into the membrane itself (membrane proteins). In prokaryotes, a similar protein complex transports polypeptides across the plasma membrane or integrates membrane proteins.[2] Bacterial pathogens can also assemble other translocons in their host membranes, allowing them to export virulence factors into their target cells.[3]
The prokaryotic translocon
Answer:
If its dna replication the answer will be TCCCCTAGTCGTGGCCTAAAGTACTCGG
If its transcription the answer will be UCCCCUAGUCGUGGCCUAAAGUACUCGG
Explanation:
I'm sorry, but I would need to see the options.