1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
OLga [1]
3 years ago
15

Please help 20 points and brainliest.

Biology
1 answer:
Morgarella [4.7K]3 years ago
4 0
What are the questions that go with the model?
You might be interested in
Please help asap
LenaWriter [7]

Answer:

16 KJ  or 16,720 J energy has gained by the water.

Explanation:

<em>Given data:</em>

Mass of water = m = 100 g

Temperature difference = ΔT=  (60 - 20)∘C

specific heat of water 1 calorie =  c =  4.18 J

<em>To find:</em>

Heat absorbed by water = q=?

<em>Formula:</em>

q =  m . c .  ΔT

<em>Solution:</em>

q = (100 g) x (4.18J/g ∘C) x  (60 - 20)∘C

  = 16,720 J

3 0
4 years ago
If both parents have the trait, but one of their children does not, then the trait is what
Scorpion4ik [409]

Answer:

it depends  but a good way u could figure it out is look it up online and then if u still not sure come back and ask if that answer is right  

Explanation:

3 0
2 years ago
The bases of one of the strands of DNA in a region where DNA replication begins are shown here. What is the sequence of the prim
garik1379 [7]

Answer:

Complementary primer-      3' TCCGGAGCTTAAGCATATCGAAAGTCTTT 5'

Explanation:

The synthesized primer will have base pair complementary to the given strand and also the leading and lagging ends will be opposite to the given strand.

As per the base pair rule for DNA

Guanine binds to cytosine & vice versa

Adenine always binds to thymine & vice versa

Given Sequence -                5' AGGCCTCGAATTCGTATAGCTTTCAGAAA 3'

Complementary primer-      3' TCCGGAGCTTAAGCATATCGAAAGTCTTT 5'

5 0
3 years ago
Girls begin their growth spurt around age ____, while boys begin their growth spurt around age ____.
crimeas [40]
Girls begin their growth spurt around age 10, while boys begin their growth spurt around age 12.
5 0
4 years ago
Read 2 more answers
PLEASE HELP DUE SOON 40 POINTS!
erma4kov [3.2K]

Answer:

earth's atmosphere

Explanation:

7 0
3 years ago
Other questions:
  • Which organelle serves as temporary storage of melanin or glycogen?
    11·2 answers
  • animal researchers refer to the process of filtering out sights, scents, and sounds that have little effect on survival as
    12·1 answer
  • What reads the sequence of the mRNA? What are three nucleotides that code for an amino acid called?
    8·1 answer
  • The process of nuclear division in cells that produces daughter cells that are genetically identical to each other and to the pa
    5·2 answers
  • He tells his students that _____ in the ______ help coordinate contraction of certain muscles and relaxation of others. Answers:
    15·2 answers
  • What type of electrical energy is used in homes and businesses in California and is produced from the heat energy of magma close
    13·2 answers
  • How do some cells become brain cells and other become skin cells, when the dna in all exactly the same. in other words, if the i
    12·1 answer
  • What is the representative organism of annelids?
    6·1 answer
  • Charles Darwin observed a unique beak size
    7·2 answers
  • Organisms in an ecosystem are independent. do you think humans have interdependent relationships with other organisms? explain y
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!