1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Usimov [2.4K]
3 years ago
13

Granite forms when liquid magma slowly cools within the Earth's crust. Basalt can form when lava cools on Earth's surface. What

do granite and basalt have in common? *
Can you please help with this?
Biology
2 answers:
Ivanshal [37]3 years ago
7 0

Answer:

They are both types of igneous rocks

Explanation:

FinnZ [79.3K]3 years ago
5 0

Answer:

well in some cases granite is not in fact allowed to from bacause many popele said no.

Explanation:

you see here i have no idea waht this is because i m not in this class but  

       

You might be interested in
Which of the following describes the product of Meiosis?
Olegator [25]

Answer:

C

Explanation:

meiosis made 4 haploid daughter cells, with 1 round of dna replicates and followed by 4 division of haploid daughter cells

4 0
3 years ago
Which organism is an animal-like protist?<br> cilia<br> dinoflagellates <br> amoeba<br> truffle
Nady [450]
The answer is “Amoeba”
5 0
3 years ago
Read 2 more answers
Which cells uses mitosis and meiosis
slega [8]

Answer:

Somatic cells use mitosis

Explanation:

somatic cells are body cells or skin cells

5 0
3 years ago
What is the complementary strand for the following DNA segment? C A A G T T C G A T G A
Kazeer [188]

GTTCAAGCTACTGTTCAAGCTACT

6 0
3 years ago
Given the cascade of events leading to ischemia-produced brain damage, it has been suggested that __________ antagonists adminis
Trava [24]

Answer: glutamate

Explanation: Given the cascade of events leading to ischemia-produced brain damage, it has been suggested that glutamate antagonists administered immediately after a stroke might reduce the subsequent development of brain damage.

5 0
2 years ago
Other questions:
  • The process of moving toward an area due to chemical signals is called
    15·1 answer
  • Which example is most likely an organic compound? water, which is a liquid found all over Earth glucose, which is a sugar made b
    10·2 answers
  • In the biology lab you have just finished a discussion you should do all of the following Except
    14·1 answer
  • Your roommate is 5' 1" and weighs 100 lbs what bmi category would she be in
    8·1 answer
  • The Ogallala Aquifer provides freshwater to many of the Western states.
    11·2 answers
  • Addison's disease is due to a insufficient output of glucocorticoids only. addison's disease is due to a insufficient output of
    6·1 answer
  • Which of the following is a nucleoside analog commonly used as a reverse transcriptase inhibitor in the treatment of HIV?
    9·1 answer
  • Pls answer biology y8 First answer will get brainlyest
    10·1 answer
  • The observable traits expressed by an organism are described as its ________.
    7·1 answer
  • What cause Indiana climate change?​
    5·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!