1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Rzqust [24]
2 years ago
15

5. Practice: Fill in the two processes that cause each of the following transitions.

Biology
2 answers:
xeze [42]2 years ago
6 0

Answer:

<u>Ocean to clouds:</u>When warmed by the sun, water on the surface of oceans and freshwater bodies evaporates, forming a vapor. Water vapor rises into the atmosphere, where it <u>condenses</u>, forming clouds. It then falls back to the ground as <u>precipitation</u>. Moisture can also enter the atmosphere directly from ice or snow.

Cloud→ Glacier: The moisture then cools and <u>condenses</u> onto dust in the atmosphere to form clouds. Once in cloud form, this water will STAY in the atmosphere until it precipitates to the ground and collects in GLACIERS, LAKES, or OCEANS.

andrey2020 [161]2 years ago
5 0

Answer:

A. Evaporation & Condensation

B. Precipitation & Freezing

Explanation:

A. From ocean to cloud --> The water on the surface of ocean must evaporate to form water vapor. Then the water vapor must rise to the atmosphere and condense to form clouds.

B. From cloud to glaciers --> The water in the cloud must precipitate to fall down to the ground as rain. Then the rain gets freezes to form glaciers.

You might be interested in
Which organism releases a toxin that causes muscle relaxation?
valentinak56 [21]
Clostridium botulinum is an anaerobic, spore-forming, bacterium organism that releases a toxin that causes muscle relaxation. The toxin that is released is a neurotoxic protein: Botulinum toxin (BTX) and <span>is produced only in an anaerobic environment. </span>This toxin is used as a a medicine to treat overactive muscle movement. 
6 0
3 years ago
Sugar water is a different kind of mixture called a
mote1985 [20]
Homogenous mixture, or a solution. 
5 0
3 years ago
Read 2 more answers
Explain how water helps to regulate temperature
inysia [295]
Because water can absorb and transfer heat well, the human body uses it to stabilize temperature. Water has a relatively high heat capacity, meaning it can absorb a lot of heat before its temperature rises. ... Water also helps expel excess heat from the body as water vapor from the lungs and sweat on the skin.





The first sentence is the answer and the other ore explanation
7 0
3 years ago
HELP!! Rank the following forms of water from most common (1) to least common (4) on Earth.
uranmaximum [27]
  1. ocean and seas
  2. river and lakes
  3. glacier
  4. ground water.

d\b\c\a

8 0
2 years ago
15 points please help
Shkiper50 [21]
Systemic circulation
4 0
3 years ago
Read 2 more answers
Other questions:
  • लघूत्सवः= *<br>लघु +उत्सवः<br>लघू +उत्सव<br>लघु +त्सवः<br><br>​
    13·1 answer
  • ¿fabrica proteínas que en lo general permanece en la célula?
    9·1 answer
  • Much like carbon, the recycling of nitrogen through Earth's spheres relies heavily on what type of organism?
    7·1 answer
  • How do aerobic bacteria differ from anaerobic bacteria?
    14·1 answer
  • Where does interphase and cytokinesis fit in relation to the four stages of mitosis?
    9·2 answers
  • What are the similarities between frog and human digestive systems
    7·1 answer
  • _____ form when muscle cells convert lactic acid to lactate.
    10·1 answer
  • NEED HELP ASAP!!!!!!!!
    6·1 answer
  • Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
    5·1 answer
  • Which of these describes the structure of a nucleic acid
    12·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!