1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Serhud [2]
2 years ago
6

1.270 calves were born from gray-variegated cattle. Of these, 136 have parental coloring. Determine the genotype and phenotype o

f the rest of the offspring, if it is known that the gray-variegated coloration occurs when crossing black and white individuals.
2.In some breeds of sheep there are animals without ears and animals with long ears. When they are crossed, animals with short ears are obtained. What offspring will be obtained by crossing short-eared animals and by crossing short-eared rams with long-eared sheep?
Biology
1 answer:
amid [387]2 years ago
5 0

Answer:

This is hard

Explanation:

You might be interested in
What makes arteries unique ?
ehidna [41]

Arteries are blood carrying vessels which have thick, elastic,  muscular walls, have no valves and in which blood flows under high pressure. The make up of arteries is unique to their function of transporting blood under high pressure. 

All arteries carry oxygenated blood from the  heart to all other parts of the body, with the exception of the pulmonary artery which carries de-oxygenated blood from the heart to the lungs. It is the only artery that transports blood which has not been oxygenated.

3 0
3 years ago
Please explain why the wind curves as it moves from high pressure to low pressure and if it causes
adell [148]

Answer:

Circulating air is diverted due to the Earth's rotation. Instead of flowing in a straight line, air in the Northern Hemisphere deflects to the right, whereas in the Southern Hemisphere it deflects to the left, resulting in curved trajectories. The Coriolis effect is the name for this deflection.

Explanation:

5 0
2 years ago
Which of the following is not a function of protein?
masha68 [24]
C. Insulating the body

Insulating the body is not a function of a protein.

Lipids are macromolecules which provide insulation. 
<span>A macromolecule is a large molecule. There are four groups of macromolecules: carbohydrates, proteins, nucleic acids and lipids. Lipids consist of glycerol and fatty acids and are constructed from fats, oils, waxes, phospholipids and steroids. A lipid's function is to insulate the body and provide warmth in cold conditions. It can be concluded that a person with very little body fat gets very cold easily and a person with a lot of body fat gets very warm very quickly.
</span>
8 0
3 years ago
Read 2 more answers
What dosage schedule is represented by the graph below?
Otrada [13]

Answer:

One pill every 5 hours.

Explanation:

3 0
3 years ago
What stage of cellular respiration produces pyruvate as a product? (2 points)
ozzi
Glycolysis produces pyruvate as a product. 
7 0
3 years ago
Read 2 more answers
Other questions:
  • A neuron that has only one axon but several dendrites is classified as a: a multipolar neuron b.bipolar c. Unipolar neuron d.mul
    9·1 answer
  • Which example is a variant of a gene?
    12·1 answer
  • What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3'
    8·1 answer
  • Metabolic regulation
    7·1 answer
  • What formula do you use to calculate the density of an object
    15·1 answer
  • The height above the ground. *
    8·1 answer
  • Select ALL of the following genotypes below that respresent males.
    13·1 answer
  • How do you think this transfer of electrons helps the lactic acid fermentation process repeat itself?
    5·1 answer
  • What is one possible positive outcome of global warming?
    8·1 answer
  • Viết sơ đồ phép lai của Men Đen có đầy đủ các thuật ngữ, kí hiệu.
    11·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!