Answer:
"GATGACATGGCGTCAGTCGATGCG" is the complete DNA sequence having 24 bases.
Explanation:
The shotgun sequencing is the process that is being used haphazard DNA strands arrangement. The nomenclature is given by the correspondence as it is growing rapidly. The pattern of firing is quasi accidental. In the preparation of DNA strands like 100 to 1000 base pairs, the chain alteration process is used. It can haphazardly break any DNA arrangement into many small pieces,and then can make copies that are completely identical to it.
Answer:
disagree, an atom has two main parts. the nucleus & electron cloud. Atoms have three subatomic particles: protons, neutrons, and electrons.
Most atoms have three different subatomic particles inside them.
Explanation:
The ATP molecule act as a power source for a cell. it is someone's compared to a battery.
Answer:
No
Explanation:
<u>That a gene is common to all murderers in the population does not mean that murderers are not at fault for their crimes. </u>
<em>Having a gene that correlates with murder just gives one a genetic tendency but the environment and personal choice still have to influence the decision to commit the crime. In other words, one might have the genetic tendency to commit murder but still has to be environmentally enabled and the ability to choose to either do it or otherwise. Nature, nurture, and personal choice would have to synergistically work together for the phenotypic expression of such a gene. </em>
