Answer:
When pollution occurs on land it travels to the waters which causes the pollutants to enter the water. When pollution enters the water, it damages the algae on the coral. It also lowers water quality, smother the coral reefs, and it speeds the growth of the damaging algae. All these make the coral reefs more susceptible to disease which stops the reefs growth and reproduction.
Explanation:
hope this helps
Answer:
chemical reactions change reactant and produce new substance called products.
Explanation:
chemical reaction is a change which will produce a new substance. ( while physical reaction does not produce a new substance.
Answer:
This is a well conserved sequence.
Explanation: BLAST a way to match or align a string of DNA or protein sequence to those that are already in a database. The way that this is done is by using statistics carefully to calculate the significance of the match. The BLAST result will produce 4 categories Max Score, Total Score, Query cover, E-Value Percent Identity. The Accession will indicate database of the sequence. In this Sequence: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT covers over 98.08% identity to the coding sequence (cds) of insulin. This sequence appears to be in a conserved region for many of the listed organism. This suggest that this part of the coding sequence for this protein is highly conserved
Answer:
hi here is your answer hope it helps
Explanation:
All living organisms share several key characteristics or functions: order, sensitivity or response to the environment, reproduction, growth and development, regulation, homeostasis, and energy processing. When viewed together, these characteristics serve to define life.
Answer: C. Fresh water will become limited in the United States.
Explanation:
were all going to die of dehydration in the future :)
