1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
kirill115 [55]
3 years ago
5

Peripheral resistance ________. select one:

Biology
1 answer:
velikii [3]3 years ago
8 0
I believe it's B. Apologies if I'm wrong.
You might be interested in
Can someone please help me
SVEN [57.7K]

Answer:

F

Explanation:

5 0
3 years ago
Read 2 more answers
Green (G) is the dominant color for pods in pea plants. Yellow (g) is
Sladkaya [172]

Answer:

No, it is not

Explanation:

Heterozygous is Gg, and if the dominant gene is there, it masks the recessive one.

5 0
3 years ago
What is The gap between two neurons is called <br>​
djverab [1.8K]

Answer:

A synapse.

Explanation:

This is where signals are transmitted through the brain, but cannot connect two neurons. The space is called a synapse.

4 0
3 years ago
What are the characteristics of the vertebrate's nervous systems?
Delicious77 [7]

Answer:

Vertebrates contain nervous system which is highly specialized organ.

Explanation:

The nervous system is the complex system in the vertebrate body which is composed of central nervous system that contain brain,spinal cord and peripheral nervous system which contain cranial nerve, spinal nerve,involuntary nerve etc.

The nervous system contain neurons that mainly transmit signal to the different parts of the body.

The peripheral nervous sytem contain somatic and visceral part.

The grey matter and white matter are the 2 areas in vertebrate nervous system.

6 0
3 years ago
What is the complementary strand for the following DNA segment? C A A G T T C G A T G A
Kazeer [188]

GTTCAAGCTACTGTTCAAGCTACT

6 0
3 years ago
Other questions:
  • Which of the following statements is not true? A. Sympathetic has extensive branching of preganglionic fibers; parasympathetic h
    8·2 answers
  • How can a build-up of carbon dioxide in the atmosphere increase Earth's global temperature?
    15·1 answer
  • What is the name of the process that produced RNA using gene as a template
    6·1 answer
  • Q 15.19: Cell bodies of preganglionic neurons of the parasympathetic division are located in which of the following cranial nerv
    10·1 answer
  • Why is photorespiration wasteful for photosynthetic organisms?
    13·1 answer
  • Arrange the events in the order they would have occurred according to the theory of endosymbiosis
    7·1 answer
  • What do we us everyday that harms us?
    15·2 answers
  • Which is the correct answer
    12·1 answer
  • Identify the organ of the digestive system.
    11·2 answers
  • What's Biological Accumulation?​
    11·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!