1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
RoseWind [281]
3 years ago
13

How do I even change my username on this app.​

Biology
2 answers:
Stella [2.4K]3 years ago
8 0
I don’t think You can’t change your name on here
maw [93]3 years ago
3 0
I don’t think you can, Chang your profile picture, you can only log out, or click on those terms and stuff
You might be interested in
If you need help friend me 4th-7th grade
marin [14]

Answer:

okay

Explanation:

just want your help

5 0
3 years ago
Neurons in the parasympathetic pathway use which neurotransmitters?
Kay [80]
<h2>Acetylcholine</h2>

Explanation:

  • Acetylcholine is a chemical that is found between the nerve synapses, or gaps, between nerve cells. When activated, it causes the contraction of skeletal muscles and activates glandular functions in the endocrine system. Think of acetylcholine as a mailperson; residents cannot receive their mail until he or she comes and delivers it to the mailbox. Like mailpersons who deliver the mail and move on to the next house, acetylcholine acts quickly and does not hang around. As a result, acetylcholine is rapidly broken down by another chemical substance called cholinesterase.
  • Acetylcholine was the first neurotransmitter scientists discovered, as well as the most abundant neurotransmitter in the body. A neurotransmitter is a chemical that is released by a neuron, or nerve cell, that sends a signal to another neuron across a synapse. The neurotransmitter binds to receptors to affect how the signal is received. The purpose of the neurotransmitter is to either amplify or inhibit the signals sent between the neurons.
  • Acetylcholine plays an important role in the signal of muscle movement, sensation of pain, learning and memory formation, the regulation of the endocrine system and rapid eye movement (REM) sleep cycles.

5 0
3 years ago
If the two oligonucleotides are allowed to anneal and the DNA polymerase and all substrates (4 dNTPs, etc.) are added to the mix
Lorico [155]

Answer:

d. T

Explanation:

For a given DNA sequence, the array is represented as:

5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'

And the premier; 5' GGACCTGTGA 3' attaches to the complementary base on the DNA sequence.

i.e.

5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'

*AGTGTCCAGG

Thus, the first nucleotide that will be incorporated into the DNA will be T

5 0
2 years ago
What element is found in all organic molecules? oxygen nitrogen phosphorus carbon
kvasek [131]
I just looked it up, it's carbon!
4 0
2 years ago
Read 2 more answers
Do we classify viruses as living? give support for both yes and no arguments.
ozzi
Viruses are classified as non-living. Although they have DNA or RNA as genetic information, a protein coat, and some, a lipidic envelope, they do not have the machinery to multiply on their own and therefore are non-living. <span>A </span>virus<span> is simply an </span>infectious agent<span> that, through different ways, many times only by releasing its genetic information inside the cell, </span>replicates<span> using other living-cells machinery</span><span>. Viruses are able to infect any type of cell.</span>
4 0
3 years ago
Read 2 more answers
Other questions:
  • A group of students went on a forest trail as part of their project activity. They were given a task of calculating the NPP of a
    13·1 answer
  • The resistance of a population to an attack by a disease to which a large proportion of the members of the group are immune is r
    6·1 answer
  • What is the function of antithrombin found in the blood and on the cells lining blood vessels?
    15·1 answer
  • are bird's warm blood'ed? or cold blooded plz no wrong anser's the right anser get's branlyest anser- and 14 pouint's :)!
    12·2 answers
  • How you can tell if the couple who is married had children?
    8·1 answer
  • What statement is true of all living organisms?
    10·1 answer
  • A group of individuals that are the same species are called a(n)
    14·1 answer
  • What are the offsprings ​
    8·2 answers
  • How do interactions among organisms affect their ecosystem
    13·1 answer
  • How do wales differ from fish
    8·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!