All categories

3 years ago

How do I even change my username on this app.

Biology

2 answers:

Stella [2.4K]3 years ago

8 0

I don’t think You can’t change your name on here

maw [93]3 years ago

3 0

I don’t think you can, Chang your profile picture, you can only log out, or click on those terms and stuff

You might be interested in

If you need help friend me 4th-7th grade

marin [14]

Answer:

okay

Explanation:

just want your help

5 0

3 years ago

Neurons in the parasympathetic pathway use which neurotransmitters?

Kay [80]

<h2>Acetylcholine</h2>

Explanation:

Acetylcholine is a chemical that is found between the nerve synapses, or gaps, between nerve cells. When activated, it causes the contraction of skeletal muscles and activates glandular functions in the endocrine system. Think of acetylcholine as a mailperson; residents cannot receive their mail until he or she comes and delivers it to the mailbox. Like mailpersons who deliver the mail and move on to the next house, acetylcholine acts quickly and does not hang around. As a result, acetylcholine is rapidly broken down by another chemical substance called cholinesterase.
Acetylcholine was the first neurotransmitter scientists discovered, as well as the most abundant neurotransmitter in the body. A neurotransmitter is a chemical that is released by a neuron, or nerve cell, that sends a signal to another neuron across a synapse. The neurotransmitter binds to receptors to affect how the signal is received. The purpose of the neurotransmitter is to either amplify or inhibit the signals sent between the neurons.
Acetylcholine plays an important role in the signal of muscle movement, sensation of pain, learning and memory formation, the regulation of the endocrine system and rapid eye movement (REM) sleep cycles.

5 0

3 years ago

If the two oligonucleotides are allowed to anneal and the DNA polymerase and all substrates (4 dNTPs, etc.) are added to the mix

Lorico [155]

Answer:

d. T

Explanation:

For a given DNA sequence, the array is represented as:

5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'

And the premier; 5' GGACCTGTGA 3' attaches to the complementary base on the DNA sequence.

i.e.

5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'

*AGTGTCCAGG

Thus, the first nucleotide that will be incorporated into the DNA will be T

5 0

2 years ago

What element is found in all organic molecules? oxygen nitrogen phosphorus carbon

kvasek [131]

I just looked it up, it's carbon!

4 0

2 years ago

Read 2 more answers

Do we classify viruses as living? give support for both yes and no arguments.

ozzi

Viruses are classified as non-living. Although they have DNA or RNA as genetic information, a protein coat, and some, a lipidic envelope, they do not have the machinery to multiply on their own and therefore are non-living. A virus is simply an infectious agent that, through different ways, many times only by releasing its genetic information inside the cell, replicates using other living-cells machinery. Viruses are able to infect any type of cell.

4 0

3 years ago

Read 2 more answers

How do I even change my username on this app.​

How do I even change my username on this app.