1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Snowcat [4.5K]
3 years ago
7

At which point is subduction occurring? O1 O2 O3 O 4

Biology
1 answer:
ASHA 777 [7]3 years ago
7 0

Answer:

The answer is O4.

Explanation:

You might be interested in
PLS HELP ME NEED THE ANSWER TODAY 50POINTS !.☺♥When would be a good time in San Francisco to collect seashells? Explain your ans
SpyIntel [72]

Answer: a low tide I would say around 5:02a.m.

Explanation:

The best shelling opportunities tend to happen during low tide, where the shells that are normally covered by water are left exposed on the sand.

7 0
4 years ago
if a single-celled organism is unable to undergo cell division, which of its life functions is affected?
castortr0y [4]

Answer:

The correct answer would be reproduction.

Single-celled organisms usually reproduce asexually with the help of cell division.

Asexual reproduction is a type of reproduction which takes place without the fusion of gametes and hence required only one parent.

Various types of asexual reproduction are fission (binary or multiple), budding, fragmentation, vegetative propagation etc.

Unicellular organism usually divide by fission either binary or multiple.

In binary fission, a parent cell divide into two equal sized daughter cells such as observed in bacteria.

In multiple fission, a parent cell divides into multiple daughter cells as observed in multiple fission of sporozoans etc. During this, parental nucleus divides several times with the help of mitosis without cytokinesis which produces several nuclei within a parent cell. The cytokinesis then takes place which results in separation and production of multiple daughter cells.

7 0
4 years ago
In humans, pigmented skin is dominant to non-pigmented skin (albinism). What is the genotype of an individual of albinism?
Rom4ik [11]
I had to look for the options and the answer for this would be HOMOZYGOUS RECESSIVE. Basing on the description above regarding pigmented skin called albinism, the genotype of this kind of individual is homozygous recessive. Hope this answers your question.
5 0
3 years ago
A briefly explain the genetic and evolutionary implications of lederberg and lederberg’s (1952 finding that mutations adapted to
balandron [24]
Lederbergs' experiment of the prevalence of mutations before selective culture was proved by replica plating. They spread bacteria on the plate and allowed them to grow. Next, they stamped the growth on the new plate which was already containing penicillin. The bacteria were able to grow on this plate, even when they never exposed to the antibiotic before. This proved that some of the bacteria were already mutated and were not as a result of exposure to selective culture conditions. 
7 0
3 years ago
The innermost cells of the<br> are continuously<br> dividing through mitosis to form new cells.
Svet_ta [14]
The innermost cells of the epidermis are continuously dividing through mitosis to form new cells. The newly formed cells move up through the epidermis toward the skin surface, while producing a tough, fibrous protein called keratin.
5 0
3 years ago
Other questions:
  • Transport of a material from the lumen (cavity) of an organ into one side of a cell and out the other side of the cell into the
    7·1 answer
  • What is the population size equation
    8·1 answer
  • Which occurs during the Krebs cycle?
    9·1 answer
  • Describe dwarf planets and their orbits in the solar system
    8·1 answer
  • How are producers and consumers related?
    7·2 answers
  • 1-5 For the following DNA sequences, replicate the DNA<br> 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC
    13·1 answer
  • Identify Three Solutions To Help Solve 3 Climate Issues
    14·2 answers
  • Why do siblings always look different from each other even though they have the same parents? *
    9·2 answers
  • The temperature of the water was measured at different depths of a pond.
    10·2 answers
  • what accounts for the significant increase in oxygen in earth's atmosphere 2 to 2.5 billion years ago?
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!