Answer:
all the inhabitants of a particular town, area, or country
Density-dependent limiting factors cause a population's per capita growth rate to ... Image credit: Environmental limits to population growth
Explanation:
Photoexcitation<span> is the photoelectrochemical process of electron excitation by photon absorption, when the energy of the photon is too low to cause photoionization. The absorption of the photon takes place in accordance with Planck's quantum theory.</span>
Explanation:
The circulatory and respiratory systems work together to circulate blood and oxygen throughout the body. Air moves in and out of the lungs through the trachea, bronchi, and bronchioles. Blood moves in and out of the lungs through the pulmonary arteries and veins that connect to the heart.
Answer:
a. Inversion
b. Duplication
Explanation:
Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.
In this case here,
Inversion is taking place here.
species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA
species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA
Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.
Deletion ❌❌
I am sure it's not feasible because deletion entails removal of a few sequences.
It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.
I believe duplication is feasible since AATT sequences are repeated once.
Our final answer,
inversion and duplication occur here.
The answer to this question is Fossil Fuels
