1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ziro4ka [17]
3 years ago
6

Please help!

Biology
1 answer:
USPshnik [31]3 years ago
3 0

Answer:

True

Explanation:

You might be interested in
The effect that yellowed or light-green leaves would have on a cucumber or tobacco plant
AURORKA [14]

Answer:

The effect would be that the green leaves, which contain chloroplasts, containing a chemical called chlorophyll would enable the plants to take in more energy in the form of sunlight, enabling the plants to photosynthesise and grow.

4 0
3 years ago
Nana has a water purifier that filters \dfrac13 3 1 ​ start fraction, 1, divided by, 3, end fraction of the contaminants each ho
Sophie [7]

Answer:

Your answer is 1/2 times 2/3 to the power of t.

Explanation:

8 0
3 years ago
Read 2 more answers
Unlike herbivores carnivores
Anton [14]
Carnoives eat meat and herbivores eat  plants
8 0
3 years ago
​the genetic code is made up of units consisting of how many nucleotides
gulaghasi [49]
64 triples of nucleotides
8 0
3 years ago
What letter is assigned to the original ( parent ) generation of true breeding plants used in Mendel's experiments?
serious [3.7K]
The answer is B: P

in which the P stands for Parent generation

hope this helped!

p.s. if you found this helpful please mark my answer as brainliest! it would mean a lot to me, thanks!
3 0
2 years ago
Read 2 more answers
Other questions:
  • Which of the following are characteristics of living things?
    11·1 answer
  • What is legnth and width of a human?
    9·2 answers
  • Compare and contrast the two<br> types of vaporization.
    7·1 answer
  • sickle cell disease in an inherited blood disorder. it is a recessive trait. that means you can carry one recessive allele for t
    7·1 answer
  • 5. Which of the rock samples below is most likely to be a metamorphic rock?
    8·2 answers
  • Consider this segment of a food web: Snails and grasshoppers eat pepper plants; spiders eat grasshoppers; shrews eat snails and
    11·1 answer
  • The mRNA generated below was produced in the<br> of the cell.<br> 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
    11·1 answer
  • What period did the earliest amphibians appear?
    9·1 answer
  • Item 5
    13·2 answers
  • How are the three stages of photosynthesis linked?
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!