1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ivanzaharov [21]
3 years ago
14

During the Berlin Conference, who was granted control of the Congo Free State?

Biology
1 answer:
nadya68 [22]3 years ago
6 0

Answer:

leopold

Explanation:

In 1884-85, a conference held in Berlin, Germany, decided the colonial status of central Africa. Suspicious of each other's ambitions in the region, the European powers and the United States agreed to grant Leopold possession of the Congo River basin.

You might be interested in
Which of the following are represented by upper and lower case letters
zimovet [89]
The answer B. Chromosomes
4 0
3 years ago
*****!!!! lots of points and brainliest!!!******** how do i find the codon and anti codon? :)​
pogonyaev

Answer:

The way to find a codon is by arranging the sequence of nitrogenous bases of the mRNA in groups of three, the triplets. Once the codon is found, the anticodon corresponds to a complementary triplet to that codon.

Explanation:

Codon corresponds to a triplet of mRNA nitrogen bases encoding an amino acid. Anticodon is responsible for carrying amino acids to the ribosome, according to the information of the mRNA, and the sequence of its triple must be complementary to that of the codon mRNA.

If, for example, a codon of the mRNA is AUG, its anticodon of the tRNA must be UAC, that is, complementary. Then, for the indicated exercises:

<u>Exercise 1:</u>

  • DNA    ATACGAAATCGCGATCGCGGCGATTCGG
  • mRNA    UAUGCUUUAGCGCUAGCGCCGCUAAGCC
  • CODON         UAU|GCU|UUA|GCG|CUA|GCG|CCG|CUA|AGC|C-
  • AntiCODON AUA|CGA|AAU|CGC|GAU|CGC|GGC|GAU|UCG|G-
  • Amino acid    Tyr|Ala|Leu|Ala|Leu|Ala|Pro|Leu|Ser

<u>Exercise 2: </u>

  • DNA    TTTACGGCCATCAGGCAATACTGG
  • mRNA    AAAUGCCGGUAGUCCGUUAUGACC
  • CODON         AAA|UGC|CGG|UAG|UCC|GUU|AUG|ACC
  • AntiCODON  UUU|ACG|GCC|AUC|AGG|CAA|UAC|UGG
  • Amino acid     Lys|Cys|Arg|Stop|Ser|Val|Met|Thr
3 0
3 years ago
How are consumers classified into different groups?
galina1969 [7]
Consumers are usually animals. Consumers cannot make their own food, so they have to eat other organisms. They can be classified into three main groups. These groups are herbivores, carnivores and omnivores.
3 0
4 years ago
A process that involves removing and analyzing part of the placenta is known as
Romashka-Z-Leto [24]
<span>That would be "Chorionic Villus Sampling"</span>
3 0
3 years ago
Which of the following would be examples of abiotic factors in a mountain river ecosystem?
melisa1 [442]
Sand , water , and minerals
6 0
3 years ago
Other questions:
  • Any help??? It would be appreciated!
    6·1 answer
  • Which of the following sequences represents the hierarchy
    8·1 answer
  • How will you compare the heart pump model and the human heart?
    14·1 answer
  • Enzymes are made of protein and a non protein therefore they can not be denatured? True or false?
    13·1 answer
  • Rh incompatibility between a sensitized Rh+ woman and an Rh- fetus can cause hemolytic disease of the newborn. True False
    15·1 answer
  • Where are the new DNA molecules formed?
    5·1 answer
  • 22 points!
    7·1 answer
  • if two black mice are crossed, the resulting offspring are as follow: 10 black mice and 3 white, what are the genotype of the pa
    8·1 answer
  • What benefit did land plants offer as they became more abundant ?
    9·1 answer
  • Biologists think that endosymbiosis gave rise to mitochondria before plastids partly because:
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!