1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Karo-lina-s [1.5K]
3 years ago
11

DNA

Biology
2 answers:
Alex787 [66]3 years ago
7 0
I’m not sure but from what I learned I think it’s B
maksim [4K]3 years ago
4 0
I think the answer is: D
You might be interested in
Explain how bees find flowers containing the nectar they require
Kaylis [27]

Answer:

The Bees find the required nectar in the flower by the "sight as well as the odor and also they receive buzz from the floral electric field".

Explanation:

The nectar are agent that are secreted for pollination, specifically cross-pollination. Bees land into or nearer to the flower. Once they landed they use their proboscis for identifying the nectar or to pick it up. Bees also receive a buzz from the flower's electric field. After sensing that electric field, bees can now identify whether the visit to the flower will be worth or not. As we already know, that bee buzz across the flower is the quest for nectar.

7 0
3 years ago
Which of the following is known as the powerhouse of the animal cell? endoplasmic reticulum, Golgi apparatus, mitochondrion or n
Mandarinka [93]
 <span>Mitochondria are known as the powerhouses of the cell

</span>
3 0
3 years ago
Read 2 more answers
Describe how eukaryotic plant cells store and remove waste.
sergiy2304 [10]
Because havee a especial character who acn do thant

3 0
3 years ago
The table lists four major groups of plants and shows whether each group has three important traits.
kirza4 [7]

Answer:

A was the answer to mine but u didn't post your diagram so I don't know

Explanation:

6 0
3 years ago
Read 2 more answers
If a scientist gets unexpected results during the first trial of an experiment, what should he or she do next?
nekit [7.7K]
Depends on the results
7 0
3 years ago
Read 2 more answers
Other questions:
  • 40 points * can someone help me.????!!! Asap
    14·2 answers
  • Why are DRIs a preferred value for nutritional intake
    7·1 answer
  • A scientist discovers a deep bowl-like divot under the ocean off the coast of eastern Mexico that is many kilometers across. The
    13·2 answers
  • Why would someone who weighs 100lb on Earth only weigh 7.7 lbs in Pluto, and
    5·1 answer
  • Pain sensations in the skin, muscles, tendons, and joints that are carried on large nerve fibers are called ________.
    8·1 answer
  • List the nitrogen bases that would form the complementary strand: TTCTACCCTACATAGACTCAT
    14·1 answer
  • In a freshwater lake, a population of bony fish called the stickleback were studied over several decades. The presence of armor
    12·2 answers
  • Help on both questions please I’ll give 98 points :)
    8·2 answers
  • What are 3 differences between Mercury and<br> Mars?
    11·1 answer
  • Cells that move around as the formless Protista amoebas do are called what?
    5·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!