Which statement accurately describes this population of alligators in Florida

Biology

1 answer:

Marrrta [24]2 years ago

7 0

Answer:

— Florida residents know that we share the state with a large alligator population — an estimated 1.3 million to be exact! And while that can be scary, alligators are fundamental to the state's wetlands.

Explanation:

You might be interested in

What do coral reefs do as producers? what do they create for the ocean

cricket20 [7]

Answer: Coral reefs are important to the ecosystem because they are the pillars on which marine and coastal ecosystems are built. They keep plants, fish, and animals fed. They clean up our water and protect our coasts.

Explanation: Hope it helps :)

3 0

1 year ago

BLAST (Basic Local Alignment Search Tool) is a powerful tool for comparing unknown sequences to sequences in online databases. I

storchak [24]

Answer:

This is a well conserved sequence.

Explanation: BLAST a way to match or align a string of DNA or protein sequence to those that are already in a database. The way that this is done is by using statistics carefully to calculate the significance of the match. The BLAST result will produce 4 categories Max Score, Total Score, Query cover, E-Value Percent Identity. The Accession will indicate database of the sequence. In this Sequence: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT covers over 98.08% identity to the coding sequence (cds) of insulin. This sequence appears to be in a conserved region for many of the listed organism. This suggest that this part of the coding sequence for this protein is highly conserved