Answer: Coral reefs are important to the ecosystem because they are the pillars on which marine and coastal ecosystems are built. They keep plants, fish, and animals fed. They clean up our water and protect our coasts.
Explanation: Hope it helps :)
Answer:
This is a well conserved sequence.
Explanation: BLAST a way to match or align a string of DNA or protein sequence to those that are already in a database. The way that this is done is by using statistics carefully to calculate the significance of the match. The BLAST result will produce 4 categories Max Score, Total Score, Query cover, E-Value Percent Identity. The Accession will indicate database of the sequence. In this Sequence: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT covers over 98.08% identity to the coding sequence (cds) of insulin. This sequence appears to be in a conserved region for many of the listed organism. This suggest that this part of the coding sequence for this protein is highly conserved
Its Gene recombination during sexual reproduction
<span />
Answer:
I'm pretty sure its Phosphate Molecule
Explanation: