1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Vika [28.1K]
3 years ago
7

if computer weather models can predict the weather into the future, why are meteorologists still needed? ​

Biology
1 answer:
xenn [34]3 years ago
8 0

Answer:

Meteorologists use computer programs called weather models to make forecasts. Since we can't collect data from the future, models have to use estimates and assumptions to predict future weather. if there are no meteorologist who would prepare those models

hope my ans helps

be sure to follow me

stay safe

have a good day

You might be interested in
DNA strand replication begins with an RNA primer. DNA strand replication begins with an RNA primer. True False
nikitadnepr [17]

Answer:

true

Explanation:

DNA synthesis is performed by the enzyme DNA polymerase. However, DNA polymerase requires the presence of a free 3' OH on the existing DNA or RNA segment. The enzyme primase forms small RNA segments that serve as primers. Primers are formed by using the DNA template strands and have free 3' OH ends. DNA polymerase extends the primers by adding deoxyribonucleotides according to the sequence of the DNA template strand. Therefore, DNA polymerases are the enzymes of primer elongation.

6 0
3 years ago
Eukaryotes that are not members of the plant, animal, and fungi kingdoms are called ____. A. protists B. decomposers C. microbes
iVinArrow [24]
Eukaryotes that are not members of the plant, animal, and fungi kingdom are called protists. 
8 0
3 years ago
Read 2 more answers
Technology can have good and bad effects. What is a bad effect of spraying pesticides on crops with the use of airplanes?
Anastaziya [24]

The correct answer is option a, that is, It is sometimes sprayed too far from the crops.

The use of pesticides on crops may exhibit a significant threat to the environment, mainly in and nearby to water sources with sensitive ecosystems, sources area, public drinking water, residential areas, and recreational waters.  

Aircraft spray of pesticides takes place from a greater altitude than the ground-based equipment and on a major scale, both of these elements may enhance the threat of spray drift.  


6 0
3 years ago
Read 2 more answers
Which label belongs in the region marked X?
LekaFEV [45]

Answer:

It's A. love :), also sorry that people answer when they don't actually know it, and there just trying to get points.

Explanation:

4 0
2 years ago
Read 2 more answers
What is the term for the remains, imprints, or traces of living things from a previous geological age?(1 point) sedimentary rock
harkovskaia [24]

Answer:

the answer is fossils

Explanation:

hope this helps

8 0
2 years ago
Other questions:
  • a star has avery low mass and its core slowly converts hydrogen to helium through fusion. what will the star become as it ages?
    13·1 answer
  • Wolves are predators for hares. the wolf population increases. what happens next?
    11·2 answers
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • Explain the importance of atp in muscle contraction and regulation
    7·1 answer
  • This is an example of which type of short-term human-induced environmental change?
    9·2 answers
  • What is not true of mitosis​
    15·1 answer
  • Positive feedback is most like _____.
    7·2 answers
  • What are the forces that struggle in the plot of a story?
    9·1 answer
  • Based on the data, which of the following is the most likely diagnosis?
    7·2 answers
  • If a DNA molecule consists of 29% Guanine, how much cytosine will it contain?
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!