1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
notka56 [123]
3 years ago
11

Say you have a 68 for your math grade. And you got a 100 on a test. What will your math grade be now.

Mathematics
1 answer:
zzz [600]3 years ago
8 0
Prob 70-74 depending on your school grading system
You might be interested in
Which are differences of perfect cubes? Select two options
schepotkina [342]

Answer: The last 3 choices

3 0
3 years ago
Read 2 more answers
A cell phone provider charges $120 per month. There is a 15% discount for those who also subscribe to home phone service. What p
Zepler [3.9K]

Answer: $102 per month

Step-by-step explanation:

15% off $120 means $120-(.15*$120) which is 120-18=$102. The .15 is the 15%, and 15% of 120 would be the whole multiplication.

5 0
3 years ago
A cellular phone company charges a $49.99 monthly fee for 600 free minutes. Each additional minute costs $.35. This month you us
aalyn [17]

First you need to subtract 750-600= 150.

Then 150 time .35=52.5.

Lastly 52.5+49.99= 102.49

6 0
3 years ago
Find the solution of the system of equations.<br> −4x+5y= 13<br> x−5y=-22
77julia77 [94]
The answer is (3,-2)
5 0
3 years ago
(hg^(-3))/(w^(-4) k^0 )
Svetlanka [38]
One may note you never quite asked anything, now, assuming simplification,

\bf ~~~~~~~~~~~~\textit{negative exponents}\\\\&#10;a^{-n} \implies \cfrac{1}{a^n}&#10;\qquad \qquad&#10;\cfrac{1}{a^n}\implies a^{-n}&#10;\qquad \qquad &#10;a^n\implies \cfrac{1}{a^{-n}}&#10;\\\\&#10;-------------------------------\\\\&#10;\cfrac{hg^{-3}}{w^{-4}k^0}\implies \cfrac{hw^4}{g^3(1)}\implies \cfrac{hw^4}{g^3}
4 0
3 years ago
Other questions:
  • The acceleration function a(t) (in m/s2) and the initial velocity v(0) are given for a particle moving along a line.
    9·1 answer
  • The area of a blackboard is
    14·2 answers
  • what is the surface area of a conical grain storage tank that has a height of 54 meters and a diameter of 18 meters
    12·2 answers
  • What time is 7 1/2 hours before 2:12 am
    8·1 answer
  • What is the complementary DNA strand for the DNA strand<br> AATTGGCCATGCATGATTACGA
    7·2 answers
  • How do you solve 6g-4=20-2g
    14·2 answers
  • Stella took a taxi from her house to the airport. The taxi company charged a pick-up fee of $1.20 plus $1.50 per mile. The total
    8·2 answers
  • Significant figures of 5.50​
    5·1 answer
  • 1. A beer that was 10 proof would contain approximately what percentage of
    9·1 answer
  • 1. Given the equation ​ ​y​ = -3​x​ + 2.5
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!