1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ratelena [41]
3 years ago
10

Which is an anthropogenic cause of acid rain?a) methane from swamps and the oceans b) burning of wood and gasses producing carbo

n dioxide c) volcanic eruptions producing large amounts of sulfur dioxide d) combustion in automobiles producing nitrous oxides
Biology
2 answers:
serious [3.7K]3 years ago
6 0
Human activities leading to chemical gas emissions
ira [324]3 years ago
3 0

Answer:

I’m pretty sure it’s d

Explanation:

the exhaust from cars, trucks, and buses releases nitrogen oxides and sulfur dioxide into the air. These pollutants cause acid rain

You might be interested in
Use the words in the word bank and arrows you draw to complete the diagram so it tells how the Sun provides the energy that driv
SSSSS [86.1K]

The correct flowchart is energy - > atmosphere - > air pressure - > convection - > global winds. This is a very simple process as explained.

<h3><u>Explanation:</u></h3>

The energy from the sun actually heats up the land surface and the water surface of the earth. As the land gets heated up, the layer of atmosphere that is adjacent to the land and water also gets heated up. This leads to the decrease of air density as the heat causes expansion of gases. With decrease in air density, the air pressure also drops and the air from the cooler layer of atmosphere above comes to fill up the space and this heated air goes up. This causes the convection current to get set up. This causes the global winds and different oceanic currents to flow all over the earth throughout the year.

5 0
3 years ago
How many elements are in this formula? How many molecules?
Mariana [72]
I only know this so far-

4 elements
Nitrogen (N)
Hydrogen (H)
Sulfur (S)
Oxygen (O)

8 0
2 years ago
Read 2 more answers
Which of the following statements is true for all types of passive transport? Group of answer choices Ions never cross the plasm
IgorLugansk [536]

Answer:

The concentration gradient is the driving force.

Explanation:

Passive transport of substance occurs when they are moved from the region of their higher concentration to that of their lower concentration. The concentration gradient is the difference in the concentration of substances between two regions or across the membrane. The concentration gradient of substances drives their passive movement. The passive movement of substances does not use metabolic energy.  Simple diffusion and facilitated diffusion are two examples of this transport.

3 0
3 years ago
Which properties are used to identify minerals? Select 3 choices.
worty [1.4K]

Used to identify properties are

  • luster
  • magnetism
  • streak
8 0
3 years ago
Read 2 more answers
Please help :). Will give brainiest!! I only need the first part don’t answer #2 or #3
marysya [2.9K]
It should be
AGATACCATGGTTACCCGGTTCCA
6 0
3 years ago
Other questions:
  • Define Neutral in Biology
    9·1 answer
  • What are two NATURAL effects of groundwater movement on the landscape?
    7·1 answer
  • Is coronary circulation the same as pulmonary circulation?
    13·1 answer
  • The regulation of gene expression in individual cells coordinates the development of multicellular organisms, ensuring that tiss
    11·1 answer
  • The atomic mass of an element whose atoms consist of elght protons, nine neutrons, and elght electrons is:
    13·1 answer
  • Scientists were able to determine the age of the earth from rock samples that were analyzed. What technique was used to do this
    5·1 answer
  • Qué tipo de células no tienen núcleo<br>​
    12·1 answer
  • ___ is the process of producing cellular energy in the presence of oxygen.
    6·1 answer
  • Which of the following is a characteristic of invasive species?
    8·1 answer
  • Neurosecretory cells make and release the hormones of the posterior pituitary. The cell bodies of these neurosecretory cells rec
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!