Heart rate is controlled by the two branches of the autonomic (involuntary) nervous system. The sympathetic nervous system (SNS) and the parasympathetic nervous system (PNS). The sympathetic nervous system (SNS) releases the hormones (catecholamines - epinephrine and norepinephrine) to accelerate the heart rate. The parasympathetic nervous system (PNS) releases the hormone acetylcholine to slow the heart rate. Such factors as stress, caffeine, and excitement may temporarily accelerate your heart rate, while meditating or taking slow, deep breaths may help to slow your heart rate.
I think its the c. archaebacteria because there are hundreds of species of archaebacteria living under the sea.....
and bacteria is harmful to all lifes of species..
Answer:
A
Explanation:
The correct answer choice is not B,C, or D so it should be A
Future generations will have the same frequencies of the A and a alleles as generation 2. Individuals with the aa genotype could be produced.
Well, basically when it says that the strand of mRNA is the opposite to DNA it means that the nitrogenous bases of DNA complement or follow base pairing rules to form the strand of mRNA.
In mRNA
A - U
G - C
T - thymine is absent and is replaced with U - uracil in mRNA.
The thymine bases in DNA are base paired with A - adenine in the mRNA strand.
So the mRNA strand would be the following :
AUGUGGGCUACGCGAGCUUCAUACGAUCUAGCUACGCAGUGGCAGCAGGCAUCACAUCGAUCGCAUUAG.
So, now that we know that this is the mRNA strand, and assuming that the top or the first part is the 5' region and the final end of the mRNA is the 3' region
Group three 3 nucleotides together in the mRNA strand and find the amino acid that the first 3 would represent in this case AUG would represent the start codon or methionine in this case it would be the start, the next would be UGG, etc, do this until you reach the final set of 3 nucleotides and the final product would be a protein consisting of whatever other amino acids were represented by the codon or 1 set of 3 nucleotides on the mRNA strand.
