1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Mila [183]
3 years ago
7

Which of the following describes an interaction between the endocrine system and the excretory system?

Biology
2 answers:
blondinia [14]3 years ago
8 0
The answer would be c. This is because hormones are apart of the endocrine system and dispose of extra salt in the body. Helping with urinating is part of the excretory system.

Hope this helps :)
Otrada [13]3 years ago
3 0

if you where me i would do c

You might be interested in
The major difference between earth and other planets in our solar system is that
babymother [125]

Answer:

Is that earth is the only planet with water and an atomoushpere that allows us to breath in

Explanation:

6 0
3 years ago
Which of the following correctly describes how nerve impulses move throughout the body?
ikadub [295]
The correct options are as follows:
1. ELECTRICAL TRANSMISSION THROUGH NEURONS AND CHEMICAL TRANSMISSION BETWEEN NEURONS [D].
Neurons, which are the nerve cells that carry nerve impulses are made up of cell body and dendrites. Electrical events propagate signals within a neuron and chemical processes transmit the signals from one neuron to the other.
2. SENSORY NEURON - BRAIN - SPINAL CORD - MOTOR NEURONS [B].
Waking up from sleep involves sensory neurons. Hearing of a strange sound is made possible by the activity of the brain. The man become alarm as a result of the message to the body from the brain via the spinal cord and running  involves motor neurons.
3. MOTOR NEURONS AND SENSORY NEURONS [A].
The peripheral nervous system is one of the two components of the nervous system and is made up of the nerves and the ganglia outside the brain and the spinal cord. The neurons of the peripheral nervous system is made up of sensory and motor neurons. The sensory neurons bring signals to the central nervous system while the motor neurons carry signals out of the central nervous system.
7 0
3 years ago
What compound is produced during regeneration?
marta [7]
Fixation during which the enzyme RuBisCO incorporates (fixes) carbon-dioxide into 3-PGA; 2. Reduction during which 3-PGA is reduced using NADPH as electron supply; 3. Regeneration during which RuBP<span> is regenerated so the cycle can start again.</span>
4 0
3 years ago
What is converting the genetic code into the language of proteins?
Ulleksa [173]


This is a process called transcription and translation.

Information to synthesize a particular protein is found in DNA in the cell nucleus. This information is copied (transcribed)  onto messenger RNA or mRNA in short. The copying process is called transcription.

mRNA then leaves the nucleus and enters the cytoplasm where it attaches to a ribosome. Transfer RNA or tRNA then begins to read (translate) the information on the attached mRNA. This is the process of translation.

tRNA then fetches amino acids that correspond to this information and brings them to the ribosome where they are linked together into a chain. This chain of amino acids is the primary structure of  the protein.

7 0
3 years ago
Read 2 more answers
I will give brainliest for the best answer
Hatshy [7]

Answer:

Scientists use the fossils around the new fossil to find its relative age.

Explanation:

7 0
3 years ago
Other questions:
  • The condition describing either: a decrease in the number of red blood cells, or the hemoglobin within the red blood cells is
    10·1 answer
  • What process occurs in a chloroplast?
    11·2 answers
  • How does a sarcomere function?
    15·2 answers
  • Aside from heat within the mantle generated by the decay of radioactive elements, the movement of the earth's tectonic plates is
    9·2 answers
  • If a plant has a high concentration of minerals inside its root cells, but does not have enough energy for active transport, wha
    11·1 answer
  • Which best explains the mechanism that allows for cell differentiation ?
    10·1 answer
  • Explain the importance of the surface area to volume of ratio
    13·1 answer
  • Osmosis does not require an additional input of energy from the cell.
    12·2 answers
  • What is an ecosystem?
    6·2 answers
  • The mRNA generated below was produced in the<br> of the cell.<br> 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!