1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Mila [183]
3 years ago
7

Which of the following describes an interaction between the endocrine system and the excretory system?

Biology
2 answers:
blondinia [14]3 years ago
8 0
The answer would be c. This is because hormones are apart of the endocrine system and dispose of extra salt in the body. Helping with urinating is part of the excretory system.

Hope this helps :)
Otrada [13]3 years ago
3 0

if you where me i would do c

You might be interested in
What is the complementary strand for the following DNA segment? C A A G T T C G A T G A
Kazeer [188]

GTTCAAGCTACTGTTCAAGCTACT

6 0
3 years ago
By which process are fossil fuels formed?
Lilit [14]
They are formed by natural processes like anærobic decomposition. They contain energy from ancient photosynthesis. They can literally be around 650 million years old.
7 0
3 years ago
Read 2 more answers
Which best describes the brain stem?
sesenic [268]
The best description about the brain stem is: it is the most important organ of our body's survival. It connects the brain and the spinal cord, controls the vital organs like the lungs and heart and it also coordinates the many essential body reflexes.
7 0
3 years ago
Keystone predators can maintain species diversity in a community if they _________. A. competitively exclude other predators B.
Alisiya [41]

Keystone predators can maintain species diversity in a community if they  prey on the community's dominant species

Option B is correct.

What is meant by keystone predator?

A keystone species is usually a dominant predator whose removal allows a prey population to explode and often decreases overall diversity. other forms of keystone species are those, like coral or beavers, that significantly alter the habitat around them and thus affect large numbers of other organisms.

Are keystone species always predators?

A keystone species is usually , but not always, a predator. Just some predators can control the distribution and population of large numbers of prey species. the whole concept of keystone species was founded on research surrounding the influence of a marine predator on its environment.

Learn more about keystone predators:

brainly.com/question/506554

#SPJ4

8 0
2 years ago
An experiment is designed to test what color of light will activate a photoelectric cell the best. The photocell is set in a cir
OleMash [197]

Answer:

The filter is the independent variable--the one that is intentionally varied.  The click rate depends upon the filter selected

hope this helps :)

8 0
3 years ago
Other questions:
  • Why might a blood cell have a different shape than a muscle cell
    7·1 answer
  • The spinal cord is an ____ extending from the medulla of the brain down to the middle of the back
    6·1 answer
  • What is one job of RNA?
    11·2 answers
  • Which theory of light is used today I need correct answer please <br>​
    5·1 answer
  • Help please....:)
    12·1 answer
  • Describe the length of the day during winter, spring, summer, and fall.
    6·1 answer
  • Match the vocabulary with the correct description.
    14·1 answer
  • Pls help and only answer if you can please
    8·2 answers
  • Que funcion realiza la celula vegetal que la aninal no podria realizar​
    14·1 answer
  • Select all that apply for gas molecules
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!