1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
IgorLugansk [536]
3 years ago
9

LMK IF I GOT THIS RIGHT PLEASE ILL GIVE BRAINLIEST

Biology
1 answer:
Triss [41]3 years ago
4 0

Answer:

The answer is "Third choice".

Explanation:

The cellular breath is a combination of microbial reactions that occur within organism cells that cycle compounds into another waste material from oxidative phosphorylation through the transition to hydrogen gas through oxygen or nutritional metabolites. It is the mixes oxygen with fatty acids through animals deflects hydrogen gas to existence activities, like waste material, water, and carbon dioxide.

You might be interested in
The science of heredity
alexandr402 [8]

Answer:

Genetics

Explanation:

Heredity refers to one's genes

4 0
3 years ago
A mutation occurs in a sex cells of a full-grown zebra the mutation to fix the genes responsible For producing blood proteins wh
Natali [406]
The zebra's descendence (offsprings) will not be able to produce blood <span>proteins (hypoproteinemia)

It touches the offspring and not the zebra itself because only the sex cells which gives spermatozoids or ovules) are touched.
The main symptom of hypoproteinemia is swelling of the legs, face and other parts of the body due to fluid accumulation loss of muscle mass.</span>
8 0
3 years ago
What is natural selection
AysviL [449]
Where organisms are better adapted to their environments tend to survive and produce more kids!
6 0
3 years ago
Read 2 more answers
The most common type of plant cell is _____. meristem sclerenchyma plasmodesmata parenchyma
Degger [83]
I'm gonna go and say it's parenchyma but I'm not 100% sure
4 0
4 years ago
Read 2 more answers
What scientific hypothesis could be used to support the theory that Wood Thrush decreases are not due to deforestation? could it
bulgar [2K]

Answer:

A scientific hypothesis can be described as a tentative statement which can either proved to be right or wrong through the support of the experiments being performed.

The possible hypothesis for the theory that Wood Thrush decreases are not due to deforestation can be as follows:

<em>'If the population of the Wood Thrush is not affected by deforestation, then the population of the Wood Thrush will remain the same when deforestation occurs in a particular area.' </em>

3 0
3 years ago
Other questions:
  • A group of students went on a forest trail as part of their project activity. They were given a task of calculating the NPP of a
    13·1 answer
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • Name the following compound: 4-ethylpentane 3-methylhexane 2-ethylpentane 3-methylpentane
    8·1 answer
  • The electric charge that eventually forms lightning is built up due to _____.
    9·2 answers
  • What is the purpose of the body mass index?
    11·2 answers
  • How does the cell cycle start off?
    5·2 answers
  • An independent variable is ___. A. directly changed by the experimenter B. manipulated by changes to the dependent variable C. a
    13·2 answers
  • What is the name of a syndrome that is the result of a defective protein
    7·1 answer
  • Which radioactive isotope would you use to date a 4-billion-year-old piece of granite?
    12·1 answer
  • 20 points for each valid answer, thanks
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!