1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
san4es73 [151]
2 years ago
12

Larry was daydreaming the day that his first grade teacher reviewed the math lesson that 5+5=10. Later, Larry was not able to re

call this information, probably because
Biology
2 answers:
julia-pushkina [17]2 years ago
7 0

Answer:

See Explanation

Explanation:

Because Larry was daydreaming and was not attentive in class,

SOVA2 [1]2 years ago
6 0
Larry was daydreaming therefore he was not actively paying attention to the teacher.
You might be interested in
In the human body, sodium—a component of salt—balances fluids, such as water, in the body. Explain how the onion experiment show
Bogdan [553]

Answer:

The salt worked like sodium on the onion.

Explanation:

5 0
2 years ago
Which of the following methods of asexual reproduction cannot occur in a unicellular organism:
Alexus [3.1K]
Fragmentation never occur in a unicellular organism !!
3 0
2 years ago
Read 2 more answers
Translate the mRNA of the above (Question 2) transcription. ... 3' tcgccctactcgcgtacaccgcgtattgac 5' turns into:
Kryger [21]

agcgggaugagcgcauguggcgcauaacug
4 0
3 years ago
What do we call a group of cells that have similar structure and function.
4vir4ik [10]

Answer: tissue

Explanation:

6 0
2 years ago
Read 2 more answers
RNAi-based modification of amylopectin content in wheat occurs through decreased expression of starch-branching enzymes. If the
kicyunya [14]

If siRNA against a starch-branching enzyme was transmitted to humans, then it may affect the expression of glycogen-branching enzymes. RNAi inhibits gene expression.

Glycogen-branching enzymes are similar to starch-branching enzymes because glycogen bonds are similar to those observed between amylopectin.

The RNA interference (RNAi) pathway is an evolutionarily conserved mechanism used in molecular biology laboratories to inhibit the expression of target genes.

In the RNAi technique, a regulatory non-coding RNA called small interfering RNA (siRNA) that exhibits sequence complementary to the target gene sequence is used to inhibit and/or block the translation of the target mRNA (in this case, starch/glycogen-branching mRNA coding enzyme).

Learn more in:

brainly.com/question/11484135

7 0
2 years ago
Other questions:
  • Mr. r's beta-thalassemia is causing him to destroy his red blood cells too rapidly. let's review the red blood cell life cycle a
    7·1 answer
  • If body temperature is too high some blood vessels increase in size and sweat glands will excrete sweat resulting in a lower bod
    15·1 answer
  • What are 3 characteristics of a solid?
    6·1 answer
  • The best evidence that there is a critical period for language acquisition is the fact that
    14·1 answer
  • According to Thorndike's law of effect,
    8·1 answer
  • What is the factored form of the polynomial x2-12x+27​
    10·2 answers
  • The name of the fruiting body for all sac fungi is ________.
    13·1 answer
  • John and Pat are identical twins with identical DNA. John works in a movie theater, and Pat works as a lifeguard. They have very
    12·2 answers
  • Two of the five types of taste buds are activated by directly hypopolarizing the taste buds; i.e. do not involve a second-messen
    14·1 answer
  • 5. Some bacteria are ___
    9·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!