1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
asambeis [7]
3 years ago
13

the chemicals in cigarette smokers are known to cause cancer propose a series of steps that could lead to the development of lun

g cancer in a smoker
Biology
1 answer:
Aleks [24]3 years ago
4 0

Answer:

Cell deterioration

Explanation:

Once the cells first come in contact, they immediately create a cell shield that is composed of weaker cells, while the rest continue their work, the problem with this, is that their is a lack of cells to do work and the weaker cells are slowly dying and creating holes for the harmful chemicals to enter, as the cells deteriorate they clot together and create a lump in a final attempt, and it ends up creating deadly weight in the lungs.

You might be interested in
The image below is an example of which level of organization,
ExtremeBDS [4]
Tissue lmk if it’s wrong
3 0
3 years ago
Through which of these medias do sound travel most slowly a.water b.wood c.iron d.air
rjkz [21]
Water.
Sound travels slowly because the amount of pressure.
6 0
2 years ago
Read 2 more answers
Dna testing was commonly used in forensic science beginning in the 1920s. True or false?
Molodets [167]

Answer:

False.

Explanation:

I am almost entirely sure that DNA testing had not been discovered at this time, but regardless of whether that is true, the very first criminal case that DNA testing was used in occurred in 1985. So no, it was not used commonly in the 20's.

8 0
2 years ago
Read 2 more answers
At the end of glycolysis,_____,_____,________ are produced, What is the net yield of ATP?
Savatey [412]

Answer:

2pyruvates

net yield of ATP=2

Explanation:

6 0
3 years ago
Explain the difference between types of scientific investigation
allsm [11]

Answer:

Hey there.

<em><u>There are three types of scientific investigations: descriptive, comparative, and experimental scenitific investigations. </u></em>

<em><u></u></em>

fist we have <em><u>Descriptive</u></em> scientific investigations.

Descriptive investigations use careful observations and measurements to develop findings.

Then we have <em><u> comparative </u></em>Investigation.

comparative investigations Involve collecting data on different populations/organisms, under different conditions (Times of year, locations), to make a comparison. for Example, Using a hand lens to examine the color and texture of four different rocks.

Lastly we have <em><u>experimental</u></em> scientific investigations.

Experimental investigations involve a process in which a "fair test" is designed and variables are actively manipulated, controlled,

I hope it helped!!!

<em>Wbob1314</em>

7 0
3 years ago
Other questions:
  • WILL GIVE THE BRAINLIEST! You must be correct though.
    14·2 answers
  • State one way in which each of the following is structurally adapted to its function:
    9·1 answer
  • How is co transport used to move glucose into the intestinal epithelial cells
    15·1 answer
  • Cold case files recently began re-investigating an old murder case. The murder took place in the park; a young man, James, was h
    12·2 answers
  • List the nitrogen bases that would form the complementary strand: TTCTACCCTACATAGACTCAT
    14·1 answer
  • Which form of energy is produced when a rubber band vibrates
    12·2 answers
  • Central temperature receptors that monitor the body's internal temperature are located within which structure of the brain? A: h
    11·1 answer
  • In your own words, what is the definition for the word Cytokinesis?
    11·2 answers
  • Fats and oils are usually stored in a plant's <br>roots <br>stem <br>fruit <br>seeds​
    8·2 answers
  • Discuss the importance of the following characteristics of living organisms​
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!