1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Zanzabum
3 years ago
10

Which statement best compares the amount of fossil fuels formed each year to the amount used each year? The amount of fossil fue

ls formed is exactly the same as the amount used. The amount of fossil fuels formed is approximately the same as the amount used. The amount of fossil fuels formed is much less than the amount used. The amount of fossil fuels formed is greater than the amount used.
Biology
2 answers:
SOVA2 [1]3 years ago
7 0

Answer:

The amount of fossil fuels formed is much less than the amount used.

Explanation:

Fossil fuels, which include petroleum, coal, natural gas etc are an example of non-renewable sources of energy. They are termed non-renewable because they are sources that gets exhausted quickly without replenishment.

One of the characteristics of non-renewable sources of energy is that they get exhausted faster than they can be produced. Hence, regarding fossil fuels as an example of non-renewable source of energy, this means that the amount of fossil fuels formed is much less than the amount used.

guajiro [1.7K]3 years ago
3 0

Answer:

it tis C

Explanation:

You might be interested in
Hi, I need help with this I don't really understand :[
Triss [41]

Answer:  Anteaters belong to the order Pilosa and the aardvarks belong to the order Tubulidentata.

Explanation:

5 0
2 years ago
What happens immediately after a mass extinction to the diversity of organisms what happens thousands or millions of years later
nirvana33 [79]

Answer:

As lineages invade different niches and become isolated from one another, they split, regenerating some of the diversity that was wiped out by the mass extinction. The upshot of all these processes is that mass extinctions tend to be followed by periods of rapid diversification and adaptive radiation

5 0
2 years ago
Which phrase describes organisms that formed index fossils?
HACTEHA [7]

Answer:

Have hard parts

Were generally large

Lived in a narrow range of geographical area

Are extinct

Explanation:

4 0
3 years ago
Read 2 more answers
The number of domains kingdoms and classification levels
Kazeer [188]
There are three domains, and six kingdoms.
8 0
2 years ago
When would a forest be sustainable?
Serga [27]

Answer:  B: When supply is greater than demand

Explanation:Hope this helps

3 0
2 years ago
Other questions:
  • help plzzzzzzzzzz. could a genetically engineered organism hybridize with a wild animal or plant? why or why not?​
    14·1 answer
  • 8. What does being called a “carrier” for a specific trait mean?
    5·1 answer
  • A parabola is defined by the equation (x − 5)2 = 12(y + 2). In which direction will the parabola open
    5·1 answer
  • Jocelyn wants to get the lead part in the school play, but to practice her lines she has reduced her exercise schedule and delay
    8·2 answers
  • Hydrogen peroxide does not make a good antiseptic for open wounds because ____________. view available hint(s) hydrogen peroxide
    13·1 answer
  • Parasitism is when
    15·2 answers
  • TRUE/FALSE: In the elongation stage of Transcription, the mRNA sequence elongates as RNA polymerase moves along the DNA
    9·1 answer
  • Question 12 of 15<br> A force is a push or pull.
    14·2 answers
  • The tRNA for GUCAUCGAUCGAUCGGAUGCC
    11·1 answer
  • Help me please thanks
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!