1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Kruka [31]
2 years ago
12

Until the middle of the 20th century, doctors sometimes suggested that

Biology
2 answers:
Alla [95]2 years ago
6 0
Not completely sure, but maybe C.?
san4es73 [151]2 years ago
5 0

Answer:

C. Studies have shown that tobacco and tar in cigarettes have negative health effects

P. S. It is perspective and it literally explains today's situation.

P. S. It explains

You might be interested in
Questions<br>1. Think of two more words that begin with 'photo'. What does each of your words mean?​
mihalych1998 [28]

Answer:

Photogenic means looking attractive in photographs or on film. Photography means a picture made using a camera, in which an image is focused onto film or other light-sensitive material and then made visible and permanent by chemical treatment, or stored digitally.

7 0
2 years ago
Read 2 more answers
1. name the mutation<br>original strand of dna:AATCGTC<br>mutated strand of dna:TAATCGTC<br>​
KIM [24]

Answer:

Insertion

Explanation:

An insertion is the addition of one or more nucleotide base pairs into a DNA sequence.

In this case, T was added to the strand

4 0
3 years ago
Which phrases describe anaerobic respiration?
Free_Kalibri [48]

Answer:

is an inefficient way to obtain ATP

creates a buildup of lactic acid

does not require oxygen

Explanation:

Anaerobic respiration is the process by which food substances are broken down without presence of oxygen. An intermediate compound, ethanol in plants and lactic acid in animals is produced. The incomplete breakdown of glucose results into production of less energy(ATP) than in the case of aerobic respiration.

7 0
3 years ago
In a food chain, energy flow begins with _____, which feed all life. plants animals humans
Juli2301 [7.4K]
Energy flow<span> in a </span>food chain<span> </span>starts with<span> the producer organisms through</span>
8 0
3 years ago
Read 2 more answers
In Madagascar scientists have discovered a moth, xanthopan morganil praedicta, that has a 30.5 cm proboscis and feeds from and p
s344n2d4d5 [400]

The size of the proboscis helps the moth to consume the food (nectar) easily from Darwin's orchid.

<h3>What do you mean by Adaptation?</h3>

Adaptation may be defined as the process of modifying one's characteristics to better suit a situation and survive more efficiently.

The size of the tube that produces nectar is just 27.9cm long, while the length of the proboscis of a moth is 30.5cm. It easily consumes the nectar and gets energy for survival as well as reproduction.

Therefore, the size of the proboscis helps the moth to consume the food (nectar) easily from Darwin's orchid.

To learn more about Adaptation, refer to the link:

brainly.com/question/1213023

#SPJ1

3 0
2 years ago
Other questions:
  • What is another name of molecular biology????
    10·2 answers
  • During reduction, PGA reacts with ATP and NADPH. What does ATP contribute to the reaction?
    8·2 answers
  • Due to __, a million species are in danger of disappearing in 20 years
    15·2 answers
  • coral reefs are especially sensitive to environmental disturbances. what are some of the factors that can damage coral reefs?
    11·1 answer
  • What 3 molecules that aren't DNA helps us learn about evolution?
    9·1 answer
  • Stem Cell Research uses two types of stem cells - Adult and Embryonic - Why is one considered ethical and the other is not?
    7·1 answer
  • Why do scientists use light-year instead of Astronomical Units to measure the distances between stars?
    5·1 answer
  • TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
    11·1 answer
  • Since Tony does not have PKU, what is the percent chance that he is a carrier
    14·1 answer
  • One of the effects of climate change is the warming of ocean and air temperatures. The gender of sea turtle offspring is determi
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!