1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Alinara [238K]
3 years ago
12

1.Water has a density of 1.0 g/ml. If I throw a rock into the water and it sinks, that means the density of the rock is ________

______ than the density of water.
2.Water has a density of 1.0 g/ml. If I throw a rock into the water and it floats, that means the density of the rock is ______________ than the density of water.

3.d=m/v. What do the three letters represent in the equation?

4.A person goes into the Dead Sea and floats. This means that their density is ________than the Dead sea.

5.The Density of a large amount of Lead is 11.2 g/ml. When I cut it in half, what happens to the density of the lead?
Biology
1 answer:
julsineya [31]3 years ago
6 0

Answer:

  1. object
  2. has a density of 1.0g/ml
  3. s=m/v
  4. dead sea
  5. it do like a adead sea
You might be interested in
Every mollusk has a head, body, and _____. jointed legs a muscular foot hinged shells an external shell
mixer [17]

Answer:  [B]:   " a muscular foot ".

______________________________________________

     "Every mollusk has a head, body, and <u>  muscular foot  </u> . "

______________________________________________

Hope this helps!

Best wishes!

_____________________________________________

8 0
3 years ago
To correctly classify a rock as igneous, sedimentary, or metamorphic, what would a geologist need to know?
Katena32 [7]
C - How the rock is formed.
5 0
2 years ago
Read 2 more answers
It is best to formulate a hypothesis and collect data BEFORE publishing a theory.
Art [367]
It is True to collect data
8 0
3 years ago
Read 2 more answers
What is common to both prokaryotic and eukaryotic cell division?
castortr0y [4]

Answer:

both are made up of cells

DNA (genetic material )

plasma membrane

cytoplasm

these are the cellular organelles which both organism share

Explanation:

5 0
3 years ago
the concentration of carbon dioxide in the atmosphere has been increasing for many years, how might this increase affect photosy
Nitella [24]

Answer:

the answer is

Carbon dioxide concentrations are rising mostly because of the fossil fuels that people are burning for energy.Increasing the light intensity increases the rate of photosynthesis, until some other factor  a limiting factor  becomes in short supply. At very high light intensities,photosynthesis is slowed and then inhibited, but these light intensities do not occur in nature.

Explanation:

8 0
2 years ago
Other questions:
  • Which organelles are believed to have originated from free-standing bacteria ingested by ancient eukaryotic cells? Chloroplasts
    7·1 answer
  • Which of the following explains why cells differentiate?
    14·2 answers
  • Why is the nucleus the most obvious organelle within a cell?
    7·1 answer
  • What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3'
    8·1 answer
  • In what ways could globalization possibly impact negatively and/or positively your current or future work environment.
    5·1 answer
  • Consider how lettuce or spinach placed in water becomes firm and crisp. Use what you have learned about cell membranes to explai
    12·2 answers
  • Which process produces diploid cells?<br> A. Mitosis<br><br> B. Meiosis
    11·2 answers
  • All body cells contain identical DNA.- true or false
    14·2 answers
  • What part of respiration does not require oxygen
    12·1 answer
  • Can someone plz help me? :((
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!