Answer:
a gradual increase in the overall temperature of the earth's atmosphere because of the greenhouse effect caused by increased levels of pollutants.
Explanation:
Answer:
a. Inversion
b. Duplication
Explanation:
Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.
In this case here,
Inversion is taking place here.
species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA
species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA
Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.
Deletion ❌❌
I am sure it's not feasible because deletion entails removal of a few sequences.
It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.
I believe duplication is feasible since AATT sequences are repeated once.
Our final answer,
inversion and duplication occur here.
Answer:
Nonrenewable energy resources, like coal, nuclear, oil, and natural gas, are available in limited supplies. This is usually due to the long time it takes for them to be replenished. Renewable resources are replenished naturally and over relatively short periods of time.
Explanation:
I believe the correct answer among the choices given above is option B. It is the tissue called phloem that the food travel from the leaves to the bulb. Phloem is a vascular tissue in plants that process sugars and other products.Hope this answers the question.
Metaphase. This is when the chromosomes line up in the center at the metaphase plate :) hope this helped!